Incidental Mutation 'R5230:Vmn1r222'
ID403731
Institutional Source Beutler Lab
Gene Symbol Vmn1r222
Ensembl Gene ENSMUSG00000061022
Gene Namevomeronasal 1 receptor 222
SynonymsV1rh16
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5230 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23232066-23233119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 23233002 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 14 (M14L)
Ref Sequence ENSEMBL: ENSMUSP00000076365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077116]
Predicted Effect probably benign
Transcript: ENSMUST00000077116
AA Change: M14L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076365
Gene: ENSMUSG00000061022
AA Change: M14L

DomainStartEndE-ValueType
Pfam:V1R 32 297 3.6e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225143
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,674,861 N1296S probably damaging Het
Abca5 A T 11: 110,319,860 D164E probably benign Het
Adamts5 T C 16: 85,870,068 D512G probably damaging Het
Ankrd11 G A 8: 122,890,477 T2191I probably benign Het
Anxa3 T C 5: 96,838,312 F270S possibly damaging Het
Bard1 A G 1: 71,053,611 probably null Het
Ccdc142 T C 6: 83,107,796 V591A probably damaging Het
Col6a3 C T 1: 90,789,054 E1613K unknown Het
Dnah9 T A 11: 66,084,666 H1519L probably damaging Het
Egf T C 3: 129,718,024 D498G possibly damaging Het
Enah A C 1: 181,935,670 probably benign Het
Fat3 A T 9: 15,990,560 N3056K possibly damaging Het
Gm4846 T A 1: 166,490,179 N223Y probably benign Het
Gm8104 A G 14: 43,101,518 N55S probably damaging Het
Gpatch8 A G 11: 102,479,578 S1045P probably damaging Het
Haus4 A G 14: 54,543,794 M275T probably benign Het
Ighe T A 12: 113,271,386 T385S unknown Het
Ipo9 G A 1: 135,420,070 S78L probably damaging Het
Kif21b G A 1: 136,171,673 V1473M probably damaging Het
Lama1 T A 17: 67,745,083 Y345* probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Loxl3 A G 6: 83,035,794 T105A probably benign Het
Map4k3 A G 17: 80,615,170 S441P probably benign Het
Med12l C T 3: 59,245,788 T1078I probably damaging Het
Mef2c T A 13: 83,652,907 M242K possibly damaging Het
Morc2b A G 17: 33,136,252 Y849H probably benign Het
Mroh2b T A 15: 4,941,522 V1003E probably benign Het
Myo15 T A 11: 60,502,848 M1135K possibly damaging Het
Nckap1l A T 15: 103,483,639 I834F probably benign Het
Nrg1 T A 8: 31,818,479 Y503F probably damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1314 A T 2: 112,092,389 I104N probably benign Het
Pcdhga2 T C 18: 37,669,742 V213A probably benign Het
Pdzd2 A T 15: 12,390,033 M826K probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Rnf38 T C 4: 44,149,176 Q57R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpina6 T C 12: 103,651,898 T219A probably benign Het
Spata31d1c T A 13: 65,035,434 N263K probably benign Het
Spef2 T G 15: 9,667,230 I791L possibly damaging Het
Sv2a T C 3: 96,185,460 C159R probably damaging Het
Tbc1d31 T A 15: 57,960,919 L859Q probably damaging Het
Tecta C A 9: 42,394,943 R63L probably damaging Het
Tex52 A G 6: 128,384,816 E252G probably damaging Het
Tnfsf13b A G 8: 10,031,608 I257V possibly damaging Het
Tpk1 A G 6: 43,423,719 L172P probably damaging Het
Trim3 T G 7: 105,619,513 N78T possibly damaging Het
Try5 A G 6: 41,312,378 V88A probably benign Het
Wdr90 A T 17: 25,855,303 V678E probably benign Het
Zan A G 5: 137,454,078 L1543P unknown Het
Other mutations in Vmn1r222
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Vmn1r222 APN 13 23232889 missense probably benign 0.45
IGL01960:Vmn1r222 APN 13 23232145 missense probably benign 0.00
IGL02082:Vmn1r222 APN 13 23232329 missense probably damaging 1.00
IGL02616:Vmn1r222 APN 13 23232141 missense possibly damaging 0.73
IGL03155:Vmn1r222 APN 13 23232693 missense probably damaging 1.00
IGL03333:Vmn1r222 APN 13 23233007 missense probably benign 0.18
IGL03391:Vmn1r222 APN 13 23232462 missense possibly damaging 0.94
R0137:Vmn1r222 UTSW 13 23232804 missense probably damaging 1.00
R1584:Vmn1r222 UTSW 13 23232762 missense probably damaging 1.00
R2352:Vmn1r222 UTSW 13 23232513 missense probably benign 0.35
R3079:Vmn1r222 UTSW 13 23232461 missense possibly damaging 0.75
R3080:Vmn1r222 UTSW 13 23232461 missense possibly damaging 0.75
R3963:Vmn1r222 UTSW 13 23232932 missense probably benign 0.01
R4448:Vmn1r222 UTSW 13 23232293 missense probably benign 0.11
R4448:Vmn1r222 UTSW 13 23232660 missense probably damaging 0.99
R4979:Vmn1r222 UTSW 13 23232432 missense possibly damaging 0.78
R5054:Vmn1r222 UTSW 13 23232731 missense probably damaging 0.98
R5182:Vmn1r222 UTSW 13 23232497 missense probably damaging 1.00
R5462:Vmn1r222 UTSW 13 23232875 missense probably benign 0.05
R5611:Vmn1r222 UTSW 13 23232573 missense probably damaging 1.00
R5677:Vmn1r222 UTSW 13 23232780 missense probably damaging 1.00
R6298:Vmn1r222 UTSW 13 23232795 missense probably benign 0.15
R6655:Vmn1r222 UTSW 13 23232716 missense probably damaging 1.00
R6748:Vmn1r222 UTSW 13 23232947 missense probably benign 0.00
R6912:Vmn1r222 UTSW 13 23232204 missense probably benign 0.44
R7663:Vmn1r222 UTSW 13 23232431 missense possibly damaging 0.78
R7764:Vmn1r222 UTSW 13 23232359 missense probably damaging 1.00
Z1177:Vmn1r222 UTSW 13 23232460 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTCTCCAGGTAAACAATGCTC -3'
(R):5'- TCAGGGATCTCATCTGCAAC -3'

Sequencing Primer
(F):5'- TCTTACAGCCTATGTCATCCAGGAAG -3'
(R):5'- AACATTGCATGTGTCCACCACTG -3'
Posted On2016-07-22