Incidental Mutation 'R5230:Spata31d1c'
ID403732
Institutional Source Beutler Lab
Gene Symbol Spata31d1c
Ensembl Gene ENSMUSG00000074849
Gene Namespermatogenesis associated 31 subfamily D, member 1C
Synonyms4932441B19Rik, Fam75d1c
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5230 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location65033058-65038004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65035434 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 263 (N263K)
Ref Sequence ENSEMBL: ENSMUSP00000097024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099427]
Predicted Effect probably benign
Transcript: ENSMUST00000099427
AA Change: N263K

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097024
Gene: ENSMUSG00000074849
AA Change: N263K

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:DUF4599 63 148 2.4e-31 PFAM
low complexity region 178 190 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 218 233 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
Pfam:FAM75 380 742 1.4e-120 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,674,861 N1296S probably damaging Het
Abca5 A T 11: 110,319,860 D164E probably benign Het
Adamts5 T C 16: 85,870,068 D512G probably damaging Het
Ankrd11 G A 8: 122,890,477 T2191I probably benign Het
Anxa3 T C 5: 96,838,312 F270S possibly damaging Het
Bard1 A G 1: 71,053,611 probably null Het
Ccdc142 T C 6: 83,107,796 V591A probably damaging Het
Col6a3 C T 1: 90,789,054 E1613K unknown Het
Dnah9 T A 11: 66,084,666 H1519L probably damaging Het
Egf T C 3: 129,718,024 D498G possibly damaging Het
Enah A C 1: 181,935,670 probably benign Het
Fat3 A T 9: 15,990,560 N3056K possibly damaging Het
Gm4846 T A 1: 166,490,179 N223Y probably benign Het
Gm8104 A G 14: 43,101,518 N55S probably damaging Het
Gpatch8 A G 11: 102,479,578 S1045P probably damaging Het
Haus4 A G 14: 54,543,794 M275T probably benign Het
Ighe T A 12: 113,271,386 T385S unknown Het
Ipo9 G A 1: 135,420,070 S78L probably damaging Het
Kif21b G A 1: 136,171,673 V1473M probably damaging Het
Lama1 T A 17: 67,745,083 Y345* probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Loxl3 A G 6: 83,035,794 T105A probably benign Het
Map4k3 A G 17: 80,615,170 S441P probably benign Het
Med12l C T 3: 59,245,788 T1078I probably damaging Het
Mef2c T A 13: 83,652,907 M242K possibly damaging Het
Morc2b A G 17: 33,136,252 Y849H probably benign Het
Mroh2b T A 15: 4,941,522 V1003E probably benign Het
Myo15 T A 11: 60,502,848 M1135K possibly damaging Het
Nckap1l A T 15: 103,483,639 I834F probably benign Het
Nrg1 T A 8: 31,818,479 Y503F probably damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1314 A T 2: 112,092,389 I104N probably benign Het
Pcdhga2 T C 18: 37,669,742 V213A probably benign Het
Pdzd2 A T 15: 12,390,033 M826K probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Rnf38 T C 4: 44,149,176 Q57R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpina6 T C 12: 103,651,898 T219A probably benign Het
Spef2 T G 15: 9,667,230 I791L possibly damaging Het
Sv2a T C 3: 96,185,460 C159R probably damaging Het
Tbc1d31 T A 15: 57,960,919 L859Q probably damaging Het
Tecta C A 9: 42,394,943 R63L probably damaging Het
Tex52 A G 6: 128,384,816 E252G probably damaging Het
Tnfsf13b A G 8: 10,031,608 I257V possibly damaging Het
Tpk1 A G 6: 43,423,719 L172P probably damaging Het
Trim3 T G 7: 105,619,513 N78T possibly damaging Het
Try5 A G 6: 41,312,378 V88A probably benign Het
Vmn1r222 T G 13: 23,233,002 M14L probably benign Het
Wdr90 A T 17: 25,855,303 V678E probably benign Het
Zan A G 5: 137,454,078 L1543P unknown Het
Other mutations in Spata31d1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Spata31d1c APN 13 65036089 missense probably damaging 1.00
IGL02830:Spata31d1c APN 13 65035366 missense probably benign 0.25
IGL02947:Spata31d1c APN 13 65034945 nonsense probably null
IGL03133:Spata31d1c APN 13 65034985 missense probably benign 0.18
IGL03176:Spata31d1c APN 13 65037011 missense probably benign 0.01
IGL03183:Spata31d1c APN 13 65035195 missense possibly damaging 0.86
IGL03206:Spata31d1c APN 13 65035593 missense probably benign 0.41
PIT4382001:Spata31d1c UTSW 13 65036171 missense probably benign 0.01
R0054:Spata31d1c UTSW 13 65033062 start gained probably benign
R0959:Spata31d1c UTSW 13 65036315 missense probably damaging 1.00
R1232:Spata31d1c UTSW 13 65036614 missense probably benign
R1347:Spata31d1c UTSW 13 65035388 missense probably benign 0.00
R1381:Spata31d1c UTSW 13 65036554 missense probably benign 0.08
R1573:Spata31d1c UTSW 13 65035069 missense possibly damaging 0.92
R1582:Spata31d1c UTSW 13 65033224 missense probably benign
R1639:Spata31d1c UTSW 13 65036039 missense probably benign
R1716:Spata31d1c UTSW 13 65033216 missense possibly damaging 0.86
R1781:Spata31d1c UTSW 13 65036171 missense probably benign 0.01
R1907:Spata31d1c UTSW 13 65035876 missense probably benign 0.03
R2012:Spata31d1c UTSW 13 65035227 missense possibly damaging 0.91
R2152:Spata31d1c UTSW 13 65033965 critical splice donor site probably null
R2211:Spata31d1c UTSW 13 65035939 missense probably benign 0.04
R2571:Spata31d1c UTSW 13 65036384 missense probably damaging 1.00
R2908:Spata31d1c UTSW 13 65033191 missense possibly damaging 0.63
R3978:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3979:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3980:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3981:Spata31d1c UTSW 13 65035111 missense possibly damaging 0.68
R4014:Spata31d1c UTSW 13 65035399 missense probably damaging 0.99
R4255:Spata31d1c UTSW 13 65035688 nonsense probably null
R4255:Spata31d1c UTSW 13 65035717 missense probably benign 0.04
R4592:Spata31d1c UTSW 13 65036060 missense probably damaging 0.99
R4597:Spata31d1c UTSW 13 65035613 nonsense probably null
R4624:Spata31d1c UTSW 13 65036597 missense probably benign
R4641:Spata31d1c UTSW 13 65035048 missense probably benign 0.01
R4863:Spata31d1c UTSW 13 65035790 nonsense probably null
R5084:Spata31d1c UTSW 13 65035130 missense probably damaging 0.98
R5152:Spata31d1c UTSW 13 65035595 missense probably damaging 1.00
R5267:Spata31d1c UTSW 13 65035904 missense probably damaging 0.98
R5615:Spata31d1c UTSW 13 65035264 missense possibly damaging 0.61
R5755:Spata31d1c UTSW 13 65036527 missense probably benign 0.12
R5935:Spata31d1c UTSW 13 65037080 missense possibly damaging 0.68
R6017:Spata31d1c UTSW 13 65035079 missense possibly damaging 0.91
R6131:Spata31d1c UTSW 13 65035671 missense probably benign 0.10
R6359:Spata31d1c UTSW 13 65035592 missense possibly damaging 0.63
R6723:Spata31d1c UTSW 13 65035944 missense probably benign 0.01
R7028:Spata31d1c UTSW 13 65036063 missense probably damaging 0.98
R7336:Spata31d1c UTSW 13 65036128 missense probably damaging 0.99
R7426:Spata31d1c UTSW 13 65035361 missense probably benign
R7552:Spata31d1c UTSW 13 65036123 missense probably damaging 0.98
R7605:Spata31d1c UTSW 13 65035840 missense probably benign 0.00
R7666:Spata31d1c UTSW 13 65036000 missense probably benign 0.01
X0022:Spata31d1c UTSW 13 65036927 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ATCAGAGTCTACTCCTCCTGTG -3'
(R):5'- TGTGTCTCAAGTAGTGCCACG -3'

Sequencing Primer
(F):5'- TGTGAATGCTAAATCCCCACTGG -3'
(R):5'- AGGTTTCCAGGCAATGTGAG -3'
Posted On2016-07-22