Incidental Mutation 'R0417:Slc9a8'
ID 40374
Institutional Source Beutler Lab
Gene Symbol Slc9a8
Ensembl Gene ENSMUSG00000039463
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 8
Synonyms 1200006P13Rik, 6430709P13Rik, NHE8
MMRRC Submission 038619-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0417 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 167263632-167318920 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 167299264 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 239 (T239K)
Ref Sequence ENSEMBL: ENSMUSP00000044185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047815] [ENSMUST00000073873] [ENSMUST00000109218]
AlphaFold Q8R4D1
Predicted Effect probably benign
Transcript: ENSMUST00000047815
AA Change: T239K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000044185
Gene: ENSMUSG00000039463
AA Change: T239K

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 57 468 3.3e-69 PFAM
low complexity region 497 513 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073873
AA Change: T212K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073536
Gene: ENSMUSG00000039463
AA Change: T212K

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 441 3.5e-62 PFAM
low complexity region 470 486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109218
AA Change: T212K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104841
Gene: ENSMUSG00000039463
AA Change: T212K

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 437 3.7e-61 PFAM
low complexity region 466 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155585
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Na+/H+ exchanger (NHE) family of integral membrane transporter proteins. The encoded protein is expressed on the apical membrane of the intestinal epithelial cells and plays an important role in mucosal protection. Loss of the encoded protein in mice results in a decrease in the number of goblet and mucin-positive cells, disorganization of the mucin layer, and a decrease in mucosal pH in the colon. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility, impaired mucin synthesis and bicarbonate secretion in the colon, abnormal blood coagulation and increased length of the small intestine, cecum and ileum crypts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 73,199,244 (GRCm39) K217R probably damaging Het
1810024B03Rik A G 2: 127,028,864 (GRCm39) Y112H probably damaging Het
Acot2 T C 12: 84,037,387 (GRCm39) Y234H probably benign Het
Alox12e C T 11: 70,212,691 (GRCm39) V53I probably benign Het
Ankrd50 T C 3: 38,510,510 (GRCm39) H619R probably damaging Het
Arfgef3 A T 10: 18,479,259 (GRCm39) L1452Q probably damaging Het
Arhgap42 T C 9: 9,180,034 (GRCm39) S82G possibly damaging Het
Arhgef18 T C 8: 3,438,957 (GRCm39) probably benign Het
Bicra C A 7: 15,706,247 (GRCm39) R1398L probably damaging Het
Boc T C 16: 44,340,597 (GRCm39) T118A probably benign Het
Btnl9 A G 11: 49,066,422 (GRCm39) Y381H probably damaging Het
Cbln3 T G 14: 56,121,586 (GRCm39) E20A probably benign Het
Cdc42ep5 A G 7: 4,154,482 (GRCm39) L102P probably damaging Het
Csrnp3 A G 2: 65,849,887 (GRCm39) Y171C probably benign Het
Cyp2d9 A T 15: 82,340,152 (GRCm39) I181F probably damaging Het
Cyp7b1 T A 3: 18,150,855 (GRCm39) T295S probably damaging Het
Dbn1 C T 13: 55,622,729 (GRCm39) E585K probably damaging Het
Dok1 A T 6: 83,008,550 (GRCm39) D377E probably damaging Het
Eed A T 7: 89,620,760 (GRCm39) Y87* probably null Het
Entpd3 T C 9: 120,386,487 (GRCm39) V156A probably damaging Het
Exo5 T A 4: 120,779,269 (GRCm39) T199S probably damaging Het
Extl2 T C 3: 115,818,006 (GRCm39) I106T probably benign Het
Ezh2 A G 6: 47,528,660 (GRCm39) C291R probably benign Het
Flvcr1 A T 1: 190,743,416 (GRCm39) M466K probably benign Het
Fras1 G T 5: 96,839,231 (GRCm39) M1583I probably benign Het
Fzd9 G T 5: 135,278,473 (GRCm39) R471S probably damaging Het
Galr1 A T 18: 82,423,665 (GRCm39) F204Y probably damaging Het
Gna11 A T 10: 81,366,738 (GRCm39) I324N probably damaging Het
Gucy1a2 A G 9: 3,759,484 (GRCm39) E430G possibly damaging Het
Hhatl C T 9: 121,617,828 (GRCm39) A254T probably benign Het
Ikzf1 A C 11: 11,719,352 (GRCm39) N353T probably benign Het
Il7 T A 3: 7,641,087 (GRCm39) T110S probably damaging Het
Keg1 A G 19: 12,688,424 (GRCm39) N53D probably damaging Het
Klhl21 T C 4: 152,099,964 (GRCm39) I558T probably damaging Het
Lca5l G A 16: 95,963,853 (GRCm39) T357M probably damaging Het
Lrba T C 3: 86,622,961 (GRCm39) S2448P probably damaging Het
Map3k6 T A 4: 132,975,393 (GRCm39) Y709* probably null Het
Megf6 A G 4: 154,352,424 (GRCm39) E1261G probably benign Het
Mettl3 C T 14: 52,534,155 (GRCm39) G473D probably damaging Het
Mga A G 2: 119,733,271 (GRCm39) I40V probably damaging Het
Mmp13 T A 9: 7,276,602 (GRCm39) D232E probably benign Het
Nampt T C 12: 32,883,100 (GRCm39) V95A probably benign Het
Nbeal1 T C 1: 60,286,893 (GRCm39) V905A probably benign Het
Nomo1 A T 7: 45,718,122 (GRCm39) E840V possibly damaging Het
Nprl2 A T 9: 107,420,497 (GRCm39) I101F probably damaging Het
Nup160 A T 2: 90,565,771 (GRCm39) I1378F possibly damaging Het
Ogdhl T C 14: 32,048,936 (GRCm39) S69P probably damaging Het
Or2y17 T A 11: 49,231,500 (GRCm39) I47N possibly damaging Het
Or4a68 C A 2: 89,270,519 (GRCm39) V35L possibly damaging Het
Or4k77 A G 2: 111,199,450 (GRCm39) S158G possibly damaging Het
Or5be3 A T 2: 86,863,789 (GRCm39) Y259N probably damaging Het
Or8b12i G A 9: 20,082,510 (GRCm39) A119V probably damaging Het
Or8c16 A G 9: 38,130,751 (GRCm39) I211V probably benign Het
Or8c8 T C 9: 38,165,160 (GRCm39) F149S probably benign Het
Osbpl3 C T 6: 50,324,998 (GRCm39) V167I probably benign Het
Pclo T A 5: 14,763,036 (GRCm39) H3836Q unknown Het
Prkcg A T 7: 3,352,820 (GRCm39) probably null Het
Ror1 A T 4: 100,269,197 (GRCm39) H345L possibly damaging Het
Slc36a2 C T 11: 55,072,370 (GRCm39) probably null Het
Slc40a1 G A 1: 45,950,534 (GRCm39) P306L possibly damaging Het
Snapc3 A G 4: 83,368,399 (GRCm39) I299V probably benign Het
Sp3 G A 2: 72,801,845 (GRCm39) A56V possibly damaging Het
Spag17 T A 3: 99,972,870 (GRCm39) S1361T probably benign Het
Sptbn2 A G 19: 4,787,954 (GRCm39) T978A probably benign Het
Stom C A 2: 35,211,644 (GRCm39) V126F probably damaging Het
Stpg2 A G 3: 138,924,082 (GRCm39) T162A probably damaging Het
Stxbp6 G A 12: 44,949,740 (GRCm39) T63M probably damaging Het
Tatdn1 A C 15: 58,793,199 (GRCm39) I69S probably benign Het
Tbata A T 10: 61,016,118 (GRCm39) D198V probably damaging Het
Tbc1d5 T C 17: 51,063,733 (GRCm39) I638V probably benign Het
Tomm70a A G 16: 56,970,266 (GRCm39) D548G probably benign Het
Ust A G 10: 8,121,700 (GRCm39) F303L probably damaging Het
Vps13d A G 4: 144,703,130 (GRCm39) S4306P probably benign Het
Zbed6 A T 1: 133,586,276 (GRCm39) S354T probably benign Het
Zfp691 A G 4: 119,027,693 (GRCm39) S180P possibly damaging Het
Other mutations in Slc9a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Slc9a8 APN 2 167,266,086 (GRCm39) missense possibly damaging 0.46
IGL02626:Slc9a8 APN 2 167,309,597 (GRCm39) splice site probably benign
costello UTSW 2 167,293,216 (GRCm39) missense probably damaging 1.00
R0270:Slc9a8 UTSW 2 167,293,216 (GRCm39) missense probably damaging 1.00
R0504:Slc9a8 UTSW 2 167,266,125 (GRCm39) missense probably benign
R0906:Slc9a8 UTSW 2 167,276,787 (GRCm39) intron probably benign
R1216:Slc9a8 UTSW 2 167,266,041 (GRCm39) missense probably benign 0.00
R1225:Slc9a8 UTSW 2 167,313,443 (GRCm39) missense probably benign 0.20
R1604:Slc9a8 UTSW 2 167,313,352 (GRCm39) missense probably benign 0.09
R1728:Slc9a8 UTSW 2 167,266,065 (GRCm39) missense probably benign 0.00
R1729:Slc9a8 UTSW 2 167,266,065 (GRCm39) missense probably benign 0.00
R1773:Slc9a8 UTSW 2 167,313,385 (GRCm39) missense possibly damaging 0.57
R1775:Slc9a8 UTSW 2 167,299,278 (GRCm39) missense probably benign 0.12
R1918:Slc9a8 UTSW 2 167,266,134 (GRCm39) missense possibly damaging 0.95
R2312:Slc9a8 UTSW 2 167,293,196 (GRCm39) missense probably benign 0.01
R3031:Slc9a8 UTSW 2 167,293,201 (GRCm39) missense probably damaging 1.00
R3752:Slc9a8 UTSW 2 167,299,272 (GRCm39) missense probably benign
R3757:Slc9a8 UTSW 2 167,266,050 (GRCm39) missense probably benign 0.01
R4499:Slc9a8 UTSW 2 167,266,113 (GRCm39) missense probably benign 0.01
R4746:Slc9a8 UTSW 2 167,283,090 (GRCm39) nonsense probably null
R4904:Slc9a8 UTSW 2 167,313,316 (GRCm39) missense possibly damaging 0.51
R4969:Slc9a8 UTSW 2 167,288,449 (GRCm39) missense probably benign 0.06
R5395:Slc9a8 UTSW 2 167,309,642 (GRCm39) missense probably damaging 0.99
R5811:Slc9a8 UTSW 2 167,313,307 (GRCm39) nonsense probably null
R5908:Slc9a8 UTSW 2 167,293,090 (GRCm39) intron probably benign
R6311:Slc9a8 UTSW 2 167,293,140 (GRCm39) missense probably damaging 1.00
R6443:Slc9a8 UTSW 2 167,276,741 (GRCm39) missense probably benign 0.00
R6494:Slc9a8 UTSW 2 167,266,211 (GRCm39) missense probably damaging 1.00
R7161:Slc9a8 UTSW 2 167,307,303 (GRCm39) missense possibly damaging 0.90
R7322:Slc9a8 UTSW 2 167,293,222 (GRCm39) missense probably damaging 1.00
R7354:Slc9a8 UTSW 2 167,316,051 (GRCm39) missense possibly damaging 0.93
R7896:Slc9a8 UTSW 2 167,307,278 (GRCm39) missense probably benign 0.07
R8095:Slc9a8 UTSW 2 167,310,891 (GRCm39) missense probably damaging 0.99
R8725:Slc9a8 UTSW 2 167,315,454 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCATGTTGAGACCCCTGAATCC -3'
(R):5'- GAGTGATGCCATCAAGTGTGATCCC -3'

Sequencing Primer
(F):5'- TTGAGACCCCTGAATCCTGAATG -3'
(R):5'- AAGTGTGATCCCTGCGCC -3'
Posted On 2013-05-23