Mutagenetix > Incidental Mutations

Incidental Mutation 'R5230:Adamts5'

403743

Institutional Source

Beutler Lab

Gene Symbol

Adamts5

Ensembl Gene

ENSMUSG00000022894

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)

Synonyms

9530092O11Rik, ADAM-TS5

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.198) question?

Stock #

R5230 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85856173-85901828 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85870068 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 512 (D512G)

Ref Sequence

ENSEMBL: ENSMUSP00000023611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023611]

AlphaFold

Q9R001

Predicted Effect

probably damaging
Transcript: ENSMUST00000023611
AA Change: D512G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: D512G

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	182	9.1e-18	PFAM
low complexity region	226	232	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	2.1e-16	PFAM
Pfam:Reprolysin_4	265	472	4.8e-14	PFAM
Pfam:Reprolysin	267	476	4.6e-26	PFAM
Pfam:Reprolysin_2	286	466	3.7e-13	PFAM
Pfam:Reprolysin_3	288	421	6.9e-17	PFAM
Blast:ACR	477	555	4e-15	BLAST
low complexity region	556	566	N/A	INTRINSIC
TSP1	570	622	6.04e-13	SMART
Pfam:ADAM_spacer1	732	852	1.7e-35	PFAM
TSP1	878	926	7.12e-2	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	G	6: 121,674,861	N1296S	probably damaging	Het
Abca5	A	T	11: 110,319,860	D164E	probably benign	Het
Ankrd11	G	A	8: 122,890,477	T2191I	probably benign	Het
Anxa3	T	C	5: 96,838,312	F270S	possibly damaging	Het
Bard1	A	G	1: 71,053,611		probably null	Het
Ccdc142	T	C	6: 83,107,796	V591A	probably damaging	Het
Col6a3	C	T	1: 90,789,054	E1613K	unknown	Het
Dnah9	T	A	11: 66,084,666	H1519L	probably damaging	Het
Egf	T	C	3: 129,718,024	D498G	possibly damaging	Het
Enah	A	C	1: 181,935,670		probably benign	Het
Fat3	A	T	9: 15,990,560	N3056K	possibly damaging	Het
Gm4846	T	A	1: 166,490,179	N223Y	probably benign	Het
Gm8104	A	G	14: 43,101,518	N55S	probably damaging	Het
Gpatch8	A	G	11: 102,479,578	S1045P	probably damaging	Het
Haus4	A	G	14: 54,543,794	M275T	probably benign	Het
Ighe	T	A	12: 113,271,386	T385S	unknown	Het
Ipo9	G	A	1: 135,420,070	S78L	probably damaging	Het
Kif21b	G	A	1: 136,171,673	V1473M	probably damaging	Het
Lama1	T	A	17: 67,745,083	Y345*	probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Loxl3	A	G	6: 83,035,794	T105A	probably benign	Het
Map4k3	A	G	17: 80,615,170	S441P	probably benign	Het
Med12l	C	T	3: 59,245,788	T1078I	probably damaging	Het
Mef2c	T	A	13: 83,652,907	M242K	possibly damaging	Het
Morc2b	A	G	17: 33,136,252	Y849H	probably benign	Het
Mroh2b	T	A	15: 4,941,522	V1003E	probably benign	Het
Myo15	T	A	11: 60,502,848	M1135K	possibly damaging	Het
Nckap1l	A	T	15: 103,483,639	I834F	probably benign	Het
Nrg1	T	A	8: 31,818,479	Y503F	probably damaging	Het
Numa1	T	C	7: 101,995,524	S236P	possibly damaging	Het
Olfr1314	A	T	2: 112,092,389	I104N	probably benign	Het
Pcdhga2	T	C	18: 37,669,742	V213A	probably benign	Het
Pdzd2	A	T	15: 12,390,033	M826K	probably damaging	Het
Pdzrn3	C	T	6: 101,153,311	D515N	probably damaging	Het
Rnf38	T	C	4: 44,149,176	Q57R	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Serpina6	T	C	12: 103,651,898	T219A	probably benign	Het
Spata31d1c	T	A	13: 65,035,434	N263K	probably benign	Het
Spef2	T	G	15: 9,667,230	I791L	possibly damaging	Het
Sv2a	T	C	3: 96,185,460	C159R	probably damaging	Het
Tbc1d31	T	A	15: 57,960,919	L859Q	probably damaging	Het
Tecta	C	A	9: 42,394,943	R63L	probably damaging	Het
Tex52	A	G	6: 128,384,816	E252G	probably damaging	Het
Tnfsf13b	A	G	8: 10,031,608	I257V	possibly damaging	Het
Tpk1	A	G	6: 43,423,719	L172P	probably damaging	Het
Trim3	T	G	7: 105,619,513	N78T	possibly damaging	Het
Try5	A	G	6: 41,312,378	V88A	probably benign	Het
Vmn1r222	T	G	13: 23,233,002	M14L	probably benign	Het
Wdr90	A	T	17: 25,855,303	V678E	probably benign	Het
Zan	A	G	5: 137,454,078	L1543P	unknown	Het

Other mutations in Adamts5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Adamts5	APN	16	85899834	missense	probably damaging	1.00
IGL01070:Adamts5	APN	16	85863133	missense	probably damaging	1.00
IGL01321:Adamts5	APN	16	85899475	missense	probably benign	0.03
IGL01616:Adamts5	APN	16	85887814	splice site	probably null
IGL02551:Adamts5	APN	16	85870038	missense	possibly damaging	0.71
IGL03263:Adamts5	APN	16	85869942	missense	probably damaging	0.99
IGL03295:Adamts5	APN	16	85877945	missense	probably damaging	1.00
IGL03393:Adamts5	APN	16	85868195	missense	probably damaging	0.99
IGL03403:Adamts5	APN	16	85863014	missense	probably damaging	0.97
R0414:Adamts5	UTSW	16	85877906	missense	probably damaging	1.00
R0419:Adamts5	UTSW	16	85866642	missense	probably benign	0.00
R0539:Adamts5	UTSW	16	85868692	missense	probably damaging	1.00
R0570:Adamts5	UTSW	16	85899247	missense	probably damaging	1.00
R0574:Adamts5	UTSW	16	85899484	missense	probably damaging	0.99
R0669:Adamts5	UTSW	16	85899726	missense	probably benign	0.45
R1454:Adamts5	UTSW	16	85869993	missense	possibly damaging	0.88
R1498:Adamts5	UTSW	16	85900102	missense	possibly damaging	0.63
R1729:Adamts5	UTSW	16	85877915	nonsense	probably null
R1753:Adamts5	UTSW	16	85899352	missense	probably damaging	1.00
R1784:Adamts5	UTSW	16	85877915	nonsense	probably null
R1906:Adamts5	UTSW	16	85868685	nonsense	probably null
R1946:Adamts5	UTSW	16	85899243	missense	probably damaging	1.00
R2180:Adamts5	UTSW	16	85887924	missense	probably damaging	1.00
R2223:Adamts5	UTSW	16	85899306	missense	probably damaging	1.00
R2366:Adamts5	UTSW	16	85862758	missense	probably damaging	1.00
R3889:Adamts5	UTSW	16	85868121	missense	probably damaging	1.00
R4214:Adamts5	UTSW	16	85868643	missense	probably damaging	1.00
R4909:Adamts5	UTSW	16	85900066	nonsense	probably null
R5119:Adamts5	UTSW	16	85899578	missense	probably benign	0.00
R5452:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R5652:Adamts5	UTSW	16	85899268	missense	probably damaging	1.00
R5831:Adamts5	UTSW	16	85868118	missense	probably damaging	1.00
R6045:Adamts5	UTSW	16	85899300	missense	probably damaging	0.99
R6259:Adamts5	UTSW	16	85899753	missense	probably benign	0.03
R6384:Adamts5	UTSW	16	85862828	missense	probably benign	0.00
R6724:Adamts5	UTSW	16	85868557	missense	probably benign	0.06
R6829:Adamts5	UTSW	16	85870071	missense	possibly damaging	0.52
R7066:Adamts5	UTSW	16	85862764	missense	probably damaging	1.00
R7256:Adamts5	UTSW	16	85863035	missense	probably damaging	1.00
R7293:Adamts5	UTSW	16	85899945	missense	probably benign	0.10
R7298:Adamts5	UTSW	16	85899918	missense	probably benign	0.35
R7384:Adamts5	UTSW	16	85899826	missense	probably benign	0.02
R7452:Adamts5	UTSW	16	85877981	missense	probably benign	0.00
R7727:Adamts5	UTSW	16	85899966	missense	probably damaging	1.00
R7785:Adamts5	UTSW	16	85863004	missense	probably damaging	0.99
R7894:Adamts5	UTSW	16	85877920	nonsense	probably null
R8111:Adamts5	UTSW	16	85899315	missense	probably damaging	1.00
R8370:Adamts5	UTSW	16	85899993	missense	possibly damaging	0.74
R8413:Adamts5	UTSW	16	85866618	critical splice donor site	probably null
R8505:Adamts5	UTSW	16	85900056	missense	probably benign	0.42
R8804:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R9209:Adamts5	UTSW	16	85870083	missense	probably damaging	1.00
X0062:Adamts5	UTSW	16	85863157	missense	probably damaging	1.00
Z1177:Adamts5	UTSW	16	85870074	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGCCTGGAAAAGCACTTC -3'
(R):5'- TACTTCTTAGGTCGCTGGTTATAGC -3'

Sequencing Primer
(F):5'- CACTTCCTGTGTTGGGTCTCG -3'
(R):5'- GGTCGCTGGTTATAGCAATTTGAAAC -3'

Posted On

2016-07-22