Incidental Mutation 'R5273:Snrpe'
ID403751
Institutional Source Beutler Lab
Gene Symbol Snrpe
Ensembl Gene ENSMUSG00000090553
Gene Namesmall nuclear ribonucleoprotein E
Synonyms
MMRRC Submission 042862-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R5273 (G1)
Quality Score212
Status Not validated
Chromosome1
Chromosomal Location133603871-133610291 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to C at 133609780 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164096] [ENSMUST00000164574] [ENSMUST00000166291] [ENSMUST00000166915] [ENSMUST00000171264] [ENSMUST00000172079]
Predicted Effect probably benign
Transcript: ENSMUST00000164096
SMART Domains Protein: ENSMUSP00000127164
Gene: ENSMUSG00000090553

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Sm 23 83 9.42e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000164574
AA Change: V49G
SMART Domains Protein: ENSMUSP00000131061
Gene: ENSMUSG00000090553
AA Change: V49G

DomainStartEndE-ValueType
low complexity region 35 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166291
SMART Domains Protein: ENSMUSP00000132376
Gene: ENSMUSG00000090553

DomainStartEndE-ValueType
PDB:4F7U|H 1 48 7e-19 PDB
SCOP:d1b34b_ 16 47 1e-3 SMART
Blast:Sm 23 48 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166915
SMART Domains Protein: ENSMUSP00000128400
Gene: ENSMUSG00000090553

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Sm 23 89 9.84e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171264
Predicted Effect unknown
Transcript: ENSMUST00000172079
AA Change: V49G
SMART Domains Protein: ENSMUSP00000133244
Gene: ENSMUSG00000090553
AA Change: V49G

DomainStartEndE-ValueType
low complexity region 35 52 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180718
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice heterozygous for an ENU-induced mutation display severely decreased testis weight and reduced spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,341 S2603P probably damaging Het
2410089E03Rik T C 15: 8,262,938 S3012P unknown Het
Abcc4 T C 14: 118,594,821 N799S possibly damaging Het
Arhgap20 A G 9: 51,848,616 N589S probably damaging Het
Armc10 C T 5: 21,653,428 A157V possibly damaging Het
Atp2b2 A G 6: 113,759,232 L958P probably damaging Het
Bhmt2 G A 13: 93,666,578 A149V possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Ccdc7a CATCAGCTGATAT CAT 8: 129,061,609 probably null Het
Cntnap4 A G 8: 112,733,438 D141G probably damaging Het
Dis3 A G 14: 99,098,806 V88A probably benign Het
Dnajc21 A T 15: 10,454,807 C316S probably damaging Het
Dnhd1 A G 7: 105,714,482 T4084A probably damaging Het
Dock3 A C 9: 106,900,705 probably null Het
Eml5 T C 12: 98,790,688 H1894R probably damaging Het
Galc T C 12: 98,252,071 Y174C probably damaging Het
Gm4841 C T 18: 60,270,743 V93I probably benign Het
Gm7995 T C 14: 42,311,456 Y98H probably damaging Het
Gnrhr T A 5: 86,182,246 H305L possibly damaging Het
Gpr179 A T 11: 97,347,430 F323I probably damaging Het
Kdm6b G T 11: 69,404,201 P1080Q unknown Het
Man2a1 C T 17: 64,733,785 T126I probably damaging Het
Mdm4 G A 1: 132,994,582 T274M probably benign Het
Mug1 T A 6: 121,873,789 V748E probably damaging Het
Nav3 A T 10: 109,693,038 probably null Het
Olfr957 A G 9: 39,511,499 S74P possibly damaging Het
Olfr974 T C 9: 39,942,557 V99A probably benign Het
Pcdhb1 T C 18: 37,265,713 V239A probably benign Het
Ppic T A 18: 53,409,258 H126L probably damaging Het
Sdk1 T C 5: 141,998,828 F463L probably damaging Het
Shroom1 A G 11: 53,463,844 E197G possibly damaging Het
Slc22a14 A G 9: 119,170,638 S496P probably benign Het
Slc27a1 G A 8: 71,584,256 G379S probably benign Het
Slco1a5 T C 6: 142,242,098 E505G probably benign Het
Sp100 G T 1: 85,709,104 V299F possibly damaging Het
Stard9 A G 2: 120,705,087 S3942G possibly damaging Het
Ttn A G 2: 76,814,604 V12969A probably damaging Het
Txndc11 T C 16: 11,128,623 Q108R probably benign Het
Wnk4 A T 11: 101,263,869 I295F probably damaging Het
Other mutations in Snrpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02086:Snrpe APN 1 133609749 intron probably benign
IGL02565:Snrpe APN 1 133608966 splice site probably benign
IGL02942:Snrpe APN 1 133608931 missense probably damaging 0.99
R5534:Snrpe UTSW 1 133606473 missense probably benign 0.02
R5849:Snrpe UTSW 1 133608914 missense probably benign 0.01
R8338:Snrpe UTSW 1 133608943 missense probably benign 0.28
R8920:Snrpe UTSW 1 133606461 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATTAGCGCTTTCCCTGTGAC -3'
(R):5'- ATCCTACGCTGCGTGAACTC -3'

Sequencing Primer
(F):5'- GTGACCTTATCCTCAACTCTGG -3'
(R):5'- GCGATCCGCGATGAAAGC -3'
Posted On2016-07-22