Incidental Mutation 'R5273:Slc27a1'
ID403764
Institutional Source Beutler Lab
Gene Symbol Slc27a1
Ensembl Gene ENSMUSG00000031808
Gene Namesolute carrier family 27 (fatty acid transporter), member 1
SynonymsFatp, FATP1
MMRRC Submission 042862-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R5273 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location71568882-71587302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71584256 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 379 (G379S)
Ref Sequence ENSEMBL: ENSMUSP00000148768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034267] [ENSMUST00000212111] [ENSMUST00000212889] [ENSMUST00000213100]
Predicted Effect probably benign
Transcript: ENSMUST00000034267
AA Change: G379S

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034267
Gene: ENSMUSG00000031808
AA Change: G379S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:AMP-binding 82 515 2.1e-71 PFAM
Pfam:AMP-binding_C 523 598 2.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211886
Predicted Effect probably benign
Transcript: ENSMUST00000212111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212225
Predicted Effect probably benign
Transcript: ENSMUST00000212889
AA Change: G379S

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000213100
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants are protected from fat-induced insulin resistance and intramuscular accumulation of fatty acid metabolites without alterations in whole body adiposity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,341 S2603P probably damaging Het
2410089E03Rik T C 15: 8,262,938 S3012P unknown Het
Abcc4 T C 14: 118,594,821 N799S possibly damaging Het
Arhgap20 A G 9: 51,848,616 N589S probably damaging Het
Armc10 C T 5: 21,653,428 A157V possibly damaging Het
Atp2b2 A G 6: 113,759,232 L958P probably damaging Het
Bhmt2 G A 13: 93,666,578 A149V possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Ccdc7a CATCAGCTGATAT CAT 8: 129,061,609 probably null Het
Cntnap4 A G 8: 112,733,438 D141G probably damaging Het
Dis3 A G 14: 99,098,806 V88A probably benign Het
Dnajc21 A T 15: 10,454,807 C316S probably damaging Het
Dnhd1 A G 7: 105,714,482 T4084A probably damaging Het
Dock3 A C 9: 106,900,705 probably null Het
Eml5 T C 12: 98,790,688 H1894R probably damaging Het
Galc T C 12: 98,252,071 Y174C probably damaging Het
Gm4841 C T 18: 60,270,743 V93I probably benign Het
Gm7995 T C 14: 42,311,456 Y98H probably damaging Het
Gnrhr T A 5: 86,182,246 H305L possibly damaging Het
Gpr179 A T 11: 97,347,430 F323I probably damaging Het
Kdm6b G T 11: 69,404,201 P1080Q unknown Het
Man2a1 C T 17: 64,733,785 T126I probably damaging Het
Mdm4 G A 1: 132,994,582 T274M probably benign Het
Mug1 T A 6: 121,873,789 V748E probably damaging Het
Nav3 A T 10: 109,693,038 probably null Het
Olfr957 A G 9: 39,511,499 S74P possibly damaging Het
Olfr974 T C 9: 39,942,557 V99A probably benign Het
Pcdhb1 T C 18: 37,265,713 V239A probably benign Het
Ppic T A 18: 53,409,258 H126L probably damaging Het
Sdk1 T C 5: 141,998,828 F463L probably damaging Het
Shroom1 A G 11: 53,463,844 E197G possibly damaging Het
Slc22a14 A G 9: 119,170,638 S496P probably benign Het
Slco1a5 T C 6: 142,242,098 E505G probably benign Het
Snrpe A C 1: 133,609,780 probably benign Het
Sp100 G T 1: 85,709,104 V299F possibly damaging Het
Stard9 A G 2: 120,705,087 S3942G possibly damaging Het
Ttn A G 2: 76,814,604 V12969A probably damaging Het
Txndc11 T C 16: 11,128,623 Q108R probably benign Het
Wnk4 A T 11: 101,263,869 I295F probably damaging Het
Other mutations in Slc27a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Slc27a1 APN 8 71584772 critical splice donor site probably null
IGL02974:Slc27a1 APN 8 71584203 missense probably damaging 0.99
IGL03371:Slc27a1 APN 8 71585408 missense probably benign 0.20
R0178:Slc27a1 UTSW 8 71584462 missense possibly damaging 0.91
R0508:Slc27a1 UTSW 8 71580228 unclassified probably benign
R0600:Slc27a1 UTSW 8 71584164 missense probably damaging 1.00
R1169:Slc27a1 UTSW 8 71580653 missense probably benign 0.01
R1445:Slc27a1 UTSW 8 71584113 splice site probably null
R1708:Slc27a1 UTSW 8 71584630 splice site probably null
R1737:Slc27a1 UTSW 8 71570860 missense probably benign 0.05
R1850:Slc27a1 UTSW 8 71580703 critical splice donor site probably null
R2419:Slc27a1 UTSW 8 71579916 missense possibly damaging 0.81
R3817:Slc27a1 UTSW 8 71584478 missense probably damaging 1.00
R3967:Slc27a1 UTSW 8 71579787 missense probably damaging 1.00
R4243:Slc27a1 UTSW 8 71584973 missense probably benign 0.00
R4244:Slc27a1 UTSW 8 71584973 missense probably benign 0.00
R4552:Slc27a1 UTSW 8 71580066 splice site probably null
R4649:Slc27a1 UTSW 8 71570764 missense probably benign 0.11
R4748:Slc27a1 UTSW 8 71580675 missense probably damaging 0.97
R4748:Slc27a1 UTSW 8 71580809 missense possibly damaging 0.94
R5913:Slc27a1 UTSW 8 71584263 missense probably benign 0.31
R6958:Slc27a1 UTSW 8 71585439 missense possibly damaging 0.49
R7198:Slc27a1 UTSW 8 71579427 missense possibly damaging 0.94
R7212:Slc27a1 UTSW 8 71584448 missense probably damaging 1.00
R8210:Slc27a1 UTSW 8 71579922 missense probably benign 0.01
R8822:Slc27a1 UTSW 8 71580664 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGAATGCCTGCTTAGC -3'
(R):5'- TCATTGACCTTGACCAGACG -3'

Sequencing Primer
(F):5'- GCATATAGCCCTTGGTTGCAG -3'
(R):5'- TTGACCTTGACCAGACGGATGG -3'
Posted On2016-07-22