Incidental Mutation 'R5273:Ccdc7a'
ID403766
Institutional Source Beutler Lab
Gene Symbol Ccdc7a
Ensembl Gene ENSMUSG00000025808
Gene Namecoiled-coil domain containing 7A
SynonymsCcdc7, 4930517G15Rik, 4930540C21Rik
MMRRC Submission 042862-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5273 (G1)
Quality Score217
Status Not validated
Chromosome8
Chromosomal Location128734235-129065517 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CATCAGCTGATAT to CAT at 129061609 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095158] [ENSMUST00000108747] [ENSMUST00000125112] [ENSMUST00000214889]
Predicted Effect probably null
Transcript: ENSMUST00000095158
SMART Domains Protein: ENSMUSP00000092780
Gene: ENSMUSG00000025808

DomainStartEndE-ValueType
Pfam:BioT2 1 166 3e-79 PFAM
SCOP:d1sig__ 191 370 1e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108747
SMART Domains Protein: ENSMUSP00000104379
Gene: ENSMUSG00000025808

DomainStartEndE-ValueType
Pfam:BioT2 1 155 7.3e-70 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000125112
SMART Domains Protein: ENSMUSP00000117961
Gene: ENSMUSG00000025808

DomainStartEndE-ValueType
Pfam:BioT2 1 166 4.3e-83 PFAM
SCOP:d1sig__ 191 333 9e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000214889
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,341 S2603P probably damaging Het
2410089E03Rik T C 15: 8,262,938 S3012P unknown Het
Abcc4 T C 14: 118,594,821 N799S possibly damaging Het
Arhgap20 A G 9: 51,848,616 N589S probably damaging Het
Armc10 C T 5: 21,653,428 A157V possibly damaging Het
Atp2b2 A G 6: 113,759,232 L958P probably damaging Het
Bhmt2 G A 13: 93,666,578 A149V possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Cntnap4 A G 8: 112,733,438 D141G probably damaging Het
Dis3 A G 14: 99,098,806 V88A probably benign Het
Dnajc21 A T 15: 10,454,807 C316S probably damaging Het
Dnhd1 A G 7: 105,714,482 T4084A probably damaging Het
Dock3 A C 9: 106,900,705 probably null Het
Eml5 T C 12: 98,790,688 H1894R probably damaging Het
Galc T C 12: 98,252,071 Y174C probably damaging Het
Gm4841 C T 18: 60,270,743 V93I probably benign Het
Gm7995 T C 14: 42,311,456 Y98H probably damaging Het
Gnrhr T A 5: 86,182,246 H305L possibly damaging Het
Gpr179 A T 11: 97,347,430 F323I probably damaging Het
Kdm6b G T 11: 69,404,201 P1080Q unknown Het
Man2a1 C T 17: 64,733,785 T126I probably damaging Het
Mdm4 G A 1: 132,994,582 T274M probably benign Het
Mug1 T A 6: 121,873,789 V748E probably damaging Het
Nav3 A T 10: 109,693,038 probably null Het
Olfr957 A G 9: 39,511,499 S74P possibly damaging Het
Olfr974 T C 9: 39,942,557 V99A probably benign Het
Pcdhb1 T C 18: 37,265,713 V239A probably benign Het
Ppic T A 18: 53,409,258 H126L probably damaging Het
Sdk1 T C 5: 141,998,828 F463L probably damaging Het
Shroom1 A G 11: 53,463,844 E197G possibly damaging Het
Slc22a14 A G 9: 119,170,638 S496P probably benign Het
Slc27a1 G A 8: 71,584,256 G379S probably benign Het
Slco1a5 T C 6: 142,242,098 E505G probably benign Het
Snrpe A C 1: 133,609,780 probably benign Het
Sp100 G T 1: 85,709,104 V299F possibly damaging Het
Stard9 A G 2: 120,705,087 S3942G possibly damaging Het
Ttn A G 2: 76,814,604 V12969A probably damaging Het
Txndc11 T C 16: 11,128,623 Q108R probably benign Het
Wnk4 A T 11: 101,263,869 I295F probably damaging Het
Other mutations in Ccdc7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Ccdc7a APN 8 129026754 splice site probably benign
IGL01019:Ccdc7a APN 8 129061618 missense probably benign 0.05
IGL01553:Ccdc7a APN 8 129026591 splice site probably benign
IGL01577:Ccdc7a APN 8 128988763 missense probably damaging 0.96
IGL03114:Ccdc7a APN 8 129026689 missense possibly damaging 0.62
IGL03323:Ccdc7a APN 8 129058763 missense probably benign 0.02
R1517:Ccdc7a UTSW 8 129061681 missense probably damaging 0.99
R1804:Ccdc7a UTSW 8 128988766 nonsense probably null
R1957:Ccdc7a UTSW 8 128980135 missense probably damaging 0.99
R4926:Ccdc7a UTSW 8 128980054 intron probably benign
R4981:Ccdc7a UTSW 8 128984983 missense probably benign 0.35
R5193:Ccdc7a UTSW 8 128988797 missense probably benign 0.02
R5486:Ccdc7a UTSW 8 128985403 missense probably damaging 0.98
R5505:Ccdc7a UTSW 8 128980174 missense possibly damaging 0.73
R5562:Ccdc7a UTSW 8 129058785 missense possibly damaging 0.79
R5704:Ccdc7a UTSW 8 128980096 splice site probably benign
R6256:Ccdc7a UTSW 8 128935593 intron probably null
R6273:Ccdc7a UTSW 8 128787338 missense probably damaging 0.97
R6366:Ccdc7a UTSW 8 128855992 missense unknown
R6455:Ccdc7a UTSW 8 128832610 missense probably damaging 0.97
R6778:Ccdc7a UTSW 8 128821120 missense possibly damaging 0.66
R6882:Ccdc7a UTSW 8 128797328 intron probably benign
R6891:Ccdc7a UTSW 8 129026638 missense probably damaging 1.00
R6906:Ccdc7a UTSW 8 128935681 missense unknown
R7028:Ccdc7a UTSW 8 128881594 missense unknown
R7046:Ccdc7a UTSW 8 129047619 missense probably damaging 0.99
R7073:Ccdc7a UTSW 8 128892385 missense possibly damaging 0.46
R7268:Ccdc7a UTSW 8 128881152 missense possibly damaging 0.66
R7454:Ccdc7a UTSW 8 128944516 missense unknown
R7643:Ccdc7a UTSW 8 128889811 missense probably damaging 1.00
R7733:Ccdc7a UTSW 8 128993052 missense probably damaging 1.00
R7792:Ccdc7a UTSW 8 128892437 missense possibly damaging 0.81
R7902:Ccdc7a UTSW 8 128836173 missense possibly damaging 0.46
R7985:Ccdc7a UTSW 8 128836173 missense possibly damaging 0.46
R8032:Ccdc7a UTSW 8 128825383 missense unknown
RF008:Ccdc7a UTSW 8 128964953 missense probably damaging 0.99
Z1176:Ccdc7a UTSW 8 129026663 missense probably benign 0.41
Z1177:Ccdc7a UTSW 8 128807924 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ATGTTAAACTCCTGGTTATCTGGAATC -3'
(R):5'- CCTTATAAGAAAGGCTTACTGAATTCA -3'

Sequencing Primer
(F):5'- AAGTGATCACTACTCTGGGCACTG -3'
(R):5'- GGCTTACTGAATTCATCACCTAAGC -3'
Posted On2016-07-22