Incidental Mutation 'R0417:Lrba'
ID40378
Institutional Source Beutler Lab
Gene Symbol Lrba
Ensembl Gene ENSMUSG00000028080
Gene NameLPS-responsive beige-like anchor
SynonymsLba, D3Ertd775e
MMRRC Submission 038619-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0417 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location86224680-86782692 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86715654 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2448 (S2448P)
Ref Sequence ENSEMBL: ENSMUSP00000103261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107635] [ENSMUST00000192145] [ENSMUST00000194759] [ENSMUST00000195524]
Predicted Effect probably damaging
Transcript: ENSMUST00000107635
AA Change: S2448P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080
AA Change: S2448P

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 211 377 4.6e-13 PFAM
Pfam:DUF4704 446 717 2.5e-109 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2049 7e-88 PFAM
Pfam:PH_BEACH 2075 2172 9.1e-31 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
WD40 2760 2798 1.79e-1 SMART
WD40 2801 2840 4.28e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192145
AA Change: S2448P

PolyPhen 2 Score 0.713 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080
AA Change: S2448P

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 7.4e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.5e-92 PFAM
Pfam:PH_BEACH 2068 2172 7.5e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000194759
AA Change: S2448P

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080
AA Change: S2448P

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 8.1e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.6e-92 PFAM
Pfam:PH_BEACH 2068 2172 8.3e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000195524
AA Change: S352P

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141734
Gene: ENSMUSG00000028080
AA Change: S352P

DomainStartEndE-ValueType
Pfam:PH_BEACH 3 76 3.6e-20 PFAM
Beach 107 384 2.87e-207 SMART
WD40 482 519 7.4e0 SMART
WD40 522 565 1.72e0 SMART
WD40 581 620 3.99e-1 SMART
WD40 664 702 1.79e-1 SMART
WD40 705 744 4.28e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WDL-BEACH-WD (WBW) gene family. Its expression is induced in B cells and macrophages by bacterial lipopolysaccharides (LPS). The encoded protein associates with protein kinase A and may be involved in leading intracellular vesicles to activated receptor complexes, which aids in the secretion and/or membrane deposition of immune effector molecules. Defects in this gene are associated with the disorder common variable immunodeficiency-8 with autoimmunity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased numbers of myeloid-derived suppressor cells and regulatory T cells, abnormal NK cell physiology, impaired rejection of allogeneic, xenogeneic and missing self bone-marrow grafts, and resistance to acute graft vs host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik A G 7: 4,151,483 L102P probably damaging Het
1700030K09Rik A G 8: 72,445,400 K217R probably damaging Het
1810024B03Rik A G 2: 127,186,944 Y112H probably damaging Het
A430078G23Rik T C 8: 3,388,957 probably benign Het
Acot2 T C 12: 83,990,613 Y234H probably benign Het
Alox12e C T 11: 70,321,865 V53I probably benign Het
Ankrd50 T C 3: 38,456,361 H619R probably damaging Het
Arfgef3 A T 10: 18,603,511 L1452Q probably damaging Het
Arhgap42 T C 9: 9,180,033 S82G possibly damaging Het
Bicra C A 7: 15,972,322 R1398L probably damaging Het
Boc T C 16: 44,520,234 T118A probably benign Het
Btnl9 A G 11: 49,175,595 Y381H probably damaging Het
Cbln3 T G 14: 55,884,129 E20A probably benign Het
Csrnp3 A G 2: 66,019,543 Y171C probably benign Het
Cyp2d9 A T 15: 82,455,951 I181F probably damaging Het
Cyp7b1 T A 3: 18,096,691 T295S probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dok1 A T 6: 83,031,569 D377E probably damaging Het
Eed A T 7: 89,971,552 Y87* probably null Het
Entpd3 T C 9: 120,557,421 V156A probably damaging Het
Exo5 T A 4: 120,922,072 T199S probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Ezh2 A G 6: 47,551,726 C291R probably benign Het
Flvcr1 A T 1: 191,011,219 M466K probably benign Het
Fras1 G T 5: 96,691,372 M1583I probably benign Het
Fzd9 G T 5: 135,249,619 R471S probably damaging Het
Galr1 A T 18: 82,405,540 F204Y probably damaging Het
Gm38394 A T 1: 133,658,538 S354T probably benign Het
Gna11 A T 10: 81,530,904 I324N probably damaging Het
Gucy1a2 A G 9: 3,759,484 E430G possibly damaging Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Ikzf1 A C 11: 11,769,352 N353T probably benign Het
Il7 T A 3: 7,576,027 T110S probably damaging Het
Keg1 A G 19: 12,711,060 N53D probably damaging Het
Klhl21 T C 4: 152,015,507 I558T probably damaging Het
Lca5l G A 16: 96,162,653 T357M probably damaging Het
Map3k6 T A 4: 133,248,082 Y709* probably null Het
Megf6 A G 4: 154,267,967 E1261G probably benign Het
Mettl3 C T 14: 52,296,698 G473D probably damaging Het
Mga A G 2: 119,902,790 I40V probably damaging Het
Mmp13 T A 9: 7,276,602 D232E probably benign Het
Nampt T C 12: 32,833,101 V95A probably benign Het
Nbeal1 T C 1: 60,247,734 V905A probably benign Het
Nomo1 A T 7: 46,068,698 E840V possibly damaging Het
Nprl2 A T 9: 107,543,298 I101F probably damaging Het
Nup160 A T 2: 90,735,427 I1378F possibly damaging Het
Ogdhl T C 14: 32,326,979 S69P probably damaging Het
Olfr1105 A T 2: 87,033,445 Y259N probably damaging Het
Olfr1240 C A 2: 89,440,175 V35L possibly damaging Het
Olfr1283 A G 2: 111,369,105 S158G possibly damaging Het
Olfr1390 T A 11: 49,340,673 I47N possibly damaging Het
Olfr143 T C 9: 38,253,864 F149S probably benign Het
Olfr870 G A 9: 20,171,214 A119V probably damaging Het
Olfr894 A G 9: 38,219,455 I211V probably benign Het
Osbpl3 C T 6: 50,348,018 V167I probably benign Het
Pclo T A 5: 14,713,022 H3836Q unknown Het
Prkcg A T 7: 3,304,304 probably null Het
Ror1 A T 4: 100,412,000 H345L possibly damaging Het
Slc36a2 C T 11: 55,181,544 probably null Het
Slc40a1 G A 1: 45,911,374 P306L possibly damaging Het
Slc9a8 C A 2: 167,457,344 T239K probably benign Het
Snapc3 A G 4: 83,450,162 I299V probably benign Het
Sp3 G A 2: 72,971,501 A56V possibly damaging Het
Spag17 T A 3: 100,065,554 S1361T probably benign Het
Sptbn2 A G 19: 4,737,926 T978A probably benign Het
Stom C A 2: 35,321,632 V126F probably damaging Het
Stpg2 A G 3: 139,218,321 T162A probably damaging Het
Stxbp6 G A 12: 44,902,957 T63M probably damaging Het
Tatdn1 A C 15: 58,921,350 I69S probably benign Het
Tbata A T 10: 61,180,339 D198V probably damaging Het
Tbc1d5 T C 17: 50,756,705 I638V probably benign Het
Tomm70a A G 16: 57,149,903 D548G probably benign Het
Ust A G 10: 8,245,936 F303L probably damaging Het
Vps13d A G 4: 144,976,560 S4306P probably benign Het
Zfp691 A G 4: 119,170,496 S180P possibly damaging Het
Other mutations in Lrba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Lrba APN 3 86359782 missense probably benign 0.00
IGL00788:Lrba APN 3 86327685 missense probably damaging 0.97
IGL01139:Lrba APN 3 86642662 missense possibly damaging 0.88
IGL01302:Lrba APN 3 86295400 missense probably damaging 1.00
IGL01612:Lrba APN 3 86776177 missense possibly damaging 0.89
IGL01718:Lrba APN 3 86351248 missense probably damaging 1.00
IGL01719:Lrba APN 3 86327596 splice site probably benign
IGL01730:Lrba APN 3 86741424 missense possibly damaging 0.89
IGL01735:Lrba APN 3 86327661 missense probably benign 0.28
IGL01875:Lrba APN 3 86310047 missense probably damaging 1.00
IGL01884:Lrba APN 3 86310412 missense possibly damaging 0.86
IGL02264:Lrba APN 3 86780262 missense probably damaging 0.99
IGL02638:Lrba APN 3 86325073 missense probably damaging 0.97
IGL02647:Lrba APN 3 86359731 missense probably benign 0.00
IGL02664:Lrba APN 3 86325731 missense possibly damaging 0.84
IGL02728:Lrba APN 3 86776049 missense probably damaging 0.99
IGL02730:Lrba APN 3 86328199 missense probably damaging 1.00
IGL02883:Lrba APN 3 86354206 missense probably damaging 1.00
IGL02883:Lrba APN 3 86445413 missense probably damaging 0.99
IGL02948:Lrba APN 3 86310384 splice site probably null
IGL03090:Lrba APN 3 86773141 missense probably benign 0.01
molasses UTSW 3 86354307 critical splice donor site probably null
oscar UTSW 3 86350304 nonsense probably null
oscar2 UTSW 3 86664458 nonsense probably null
P0023:Lrba UTSW 3 86417935 missense probably damaging 1.00
PIT4802001:Lrba UTSW 3 86664494 nonsense probably null
R0077:Lrba UTSW 3 86542688 missense probably damaging 0.99
R0189:Lrba UTSW 3 86368509 missense probably damaging 1.00
R0217:Lrba UTSW 3 86642722 missense probably damaging 1.00
R0349:Lrba UTSW 3 86540005 missense probably damaging 1.00
R0396:Lrba UTSW 3 86295179 missense probably damaging 1.00
R0536:Lrba UTSW 3 86715532 missense probably damaging 1.00
R0712:Lrba UTSW 3 86297990 nonsense probably null
R0722:Lrba UTSW 3 86605989 critical splice donor site probably null
R0828:Lrba UTSW 3 86608370 splice site probably null
R0927:Lrba UTSW 3 86780233 missense probably damaging 1.00
R1120:Lrba UTSW 3 86295192 missense probably damaging 1.00
R1141:Lrba UTSW 3 86619558 missense probably damaging 1.00
R1276:Lrba UTSW 3 86664526 missense probably damaging 1.00
R1449:Lrba UTSW 3 86354278 missense probably damaging 1.00
R1470:Lrba UTSW 3 86737142 missense probably damaging 1.00
R1470:Lrba UTSW 3 86737142 missense probably damaging 1.00
R1474:Lrba UTSW 3 86780266 splice site probably benign
R1558:Lrba UTSW 3 86351315 missense probably damaging 1.00
R1596:Lrba UTSW 3 86350304 nonsense probably null
R1652:Lrba UTSW 3 86539938 missense probably damaging 1.00
R1800:Lrba UTSW 3 86351868 missense probably benign 0.00
R1819:Lrba UTSW 3 86542634 missense possibly damaging 0.80
R1862:Lrba UTSW 3 86773203 critical splice donor site probably null
R1917:Lrba UTSW 3 86664501 missense probably damaging 1.00
R1965:Lrba UTSW 3 86605868 critical splice acceptor site probably null
R1966:Lrba UTSW 3 86605868 critical splice acceptor site probably null
R1969:Lrba UTSW 3 86608389 missense probably damaging 0.99
R2011:Lrba UTSW 3 86310017 missense probably damaging 0.99
R2179:Lrba UTSW 3 86354281 missense probably damaging 1.00
R2186:Lrba UTSW 3 86304336 missense probably damaging 1.00
R2281:Lrba UTSW 3 86776103 missense possibly damaging 0.46
R2359:Lrba UTSW 3 86348750 missense probably benign 0.01
R2412:Lrba UTSW 3 86327700 missense probably damaging 1.00
R2496:Lrba UTSW 3 86532087 missense probably damaging 1.00
R3153:Lrba UTSW 3 86285219 missense probably damaging 0.99
R3708:Lrba UTSW 3 86285024 missense possibly damaging 0.80
R3746:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3747:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3748:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3749:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3750:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3758:Lrba UTSW 3 86776049 missense probably damaging 0.99
R3975:Lrba UTSW 3 86351255 missense probably damaging 1.00
R4210:Lrba UTSW 3 86360126 missense probably damaging 1.00
R4258:Lrba UTSW 3 86445349 missense probably damaging 1.00
R4657:Lrba UTSW 3 86737164 missense probably damaging 1.00
R4713:Lrba UTSW 3 86359868 missense probably benign 0.13
R4716:Lrba UTSW 3 86642714 missense probably damaging 0.99
R4811:Lrba UTSW 3 86776141 missense probably damaging 1.00
R4827:Lrba UTSW 3 86360150 missense possibly damaging 0.85
R4840:Lrba UTSW 3 86619509 critical splice acceptor site probably null
R4920:Lrba UTSW 3 86664458 nonsense probably null
R4948:Lrba UTSW 3 86285028 missense probably damaging 1.00
R4970:Lrba UTSW 3 86225371 missense probably benign 0.23
R4985:Lrba UTSW 3 86327436 splice site probably null
R4993:Lrba UTSW 3 86360037 missense probably damaging 1.00
R5107:Lrba UTSW 3 86359779 missense possibly damaging 0.47
R5112:Lrba UTSW 3 86225371 missense probably benign 0.23
R5122:Lrba UTSW 3 86349154 nonsense probably null
R5155:Lrba UTSW 3 86351300 missense probably benign 0.25
R5194:Lrba UTSW 3 86328219 missense probably damaging 1.00
R5280:Lrba UTSW 3 86325022 missense possibly damaging 0.94
R5445:Lrba UTSW 3 86368595 missense probably benign
R5469:Lrba UTSW 3 86542641 missense probably damaging 1.00
R5513:Lrba UTSW 3 86542641 missense probably damaging 1.00
R5578:Lrba UTSW 3 86757507 missense probably benign 0.27
R5740:Lrba UTSW 3 86328342 missense probably damaging 1.00
R5868:Lrba UTSW 3 86319604 missense probably damaging 1.00
R6104:Lrba UTSW 3 86353792 missense probably damaging 1.00
R6166:Lrba UTSW 3 86354307 critical splice donor site probably null
R6279:Lrba UTSW 3 86348864 missense probably benign 0.26
R6330:Lrba UTSW 3 86348357 missense probably benign 0.07
R6367:Lrba UTSW 3 86368562 missense probably benign 0.42
R6571:Lrba UTSW 3 86360060 missense probably damaging 1.00
R6584:Lrba UTSW 3 86664576 missense probably damaging 1.00
R6698:Lrba UTSW 3 86304425 missense probably damaging 0.99
R6763:Lrba UTSW 3 86354263 missense probably damaging 1.00
R6834:Lrba UTSW 3 86350286 missense probably benign 0.00
R6951:Lrba UTSW 3 86745873 missense probably benign 0.01
R6969:Lrba UTSW 3 86619590 missense probably benign 0.21
R7045:Lrba UTSW 3 86285091 missense probably benign 0.03
R7133:Lrba UTSW 3 86394931 splice site probably null
R7182:Lrba UTSW 3 86741458 frame shift probably null
R7214:Lrba UTSW 3 86328326 missense probably damaging 1.00
R7224:Lrba UTSW 3 86395246 missense probably damaging 1.00
R7243:Lrba UTSW 3 86751516 splice site probably null
R7350:Lrba UTSW 3 86351902 missense probably damaging 0.96
R7380:Lrba UTSW 3 86325074 missense probably damaging 1.00
R7492:Lrba UTSW 3 86664528 missense probably damaging 1.00
R7651:Lrba UTSW 3 86741466 nonsense probably null
R7729:Lrba UTSW 3 86318167 missense probably damaging 1.00
R7754:Lrba UTSW 3 86445397 missense probably damaging 1.00
R7762:Lrba UTSW 3 86532201 missense probably damaging 0.99
R7855:Lrba UTSW 3 86315430 missense possibly damaging 0.94
R7867:Lrba UTSW 3 86368589 missense probably damaging 1.00
R7912:Lrba UTSW 3 86715565 missense probably damaging 1.00
R7995:Lrba UTSW 3 86619551 missense probably damaging 1.00
R8013:Lrba UTSW 3 86417971 missense probably damaging 1.00
R8014:Lrba UTSW 3 86417971 missense probably damaging 1.00
R8024:Lrba UTSW 3 86295401 nonsense probably null
R8027:Lrba UTSW 3 86417912 missense probably benign 0.05
R8090:Lrba UTSW 3 86348489 missense probably benign
R8111:Lrba UTSW 3 86327705 missense probably damaging 1.00
R8118:Lrba UTSW 3 86354226 missense probably benign
R8204:Lrba UTSW 3 86315403 missense possibly damaging 0.95
R8239:Lrba UTSW 3 86542575 missense probably damaging 1.00
R8509:Lrba UTSW 3 86348176 missense probably benign 0.04
R8532:Lrba UTSW 3 86757483 missense probably damaging 1.00
R8726:Lrba UTSW 3 86353755 missense probably benign
R8744:Lrba UTSW 3 86304333 missense probably benign 0.08
R8782:Lrba UTSW 3 86642669 missense probably benign 0.00
R8784:Lrba UTSW 3 86375928 missense probably damaging 1.00
R8922:Lrba UTSW 3 86356666 missense probably damaging 1.00
R8964:Lrba UTSW 3 86351245 missense probably benign 0.22
R8971:Lrba UTSW 3 86615081 missense probably benign 0.00
R9046:Lrba UTSW 3 86395236 missense possibly damaging 0.94
X0065:Lrba UTSW 3 86297899 missense probably damaging 1.00
X0065:Lrba UTSW 3 86325089 missense possibly damaging 0.95
Z1176:Lrba UTSW 3 86715538 missense probably benign 0.31
Z1176:Lrba UTSW 3 86751532 missense possibly damaging 0.85
Z1177:Lrba UTSW 3 86540049 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAAACTCTTGTTGCGTTGC -3'
(R):5'- AACTGAGGAACAGCTTGACCTGC -3'

Sequencing Primer
(F):5'- ttctcctgccttggcttc -3'
(R):5'- AACAGCTTGACCTGCTTTGG -3'
Posted On2013-05-23