Mutagenetix > Incidental Mutation

Incidental Mutation 'R0417:Lrba'

40378

Institutional Source

Beutler Lab

Gene Symbol

Lrba

Ensembl Gene

ENSMUSG00000028080

Gene Name

LPS-responsive beige-like anchor

Synonyms

Lba, D3Ertd775e

MMRRC Submission

038619-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0417 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86224680-86782692 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86715654 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 2448 (S2448P)

Ref Sequence

ENSEMBL: ENSMUSP00000103261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107635] [ENSMUST00000192145] [ENSMUST00000194759] [ENSMUST00000195524]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000107635
AA Change: S2448P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080
AA Change: S2448P

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	211	377	4.6e-13	PFAM
Pfam:DUF4704	446	717	2.5e-109	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2049	7e-88	PFAM
Pfam:PH_BEACH	2075	2172	9.1e-31	PFAM
Beach	2203	2480	2.87e-207	SMART
WD40	2578	2615	7.4e0	SMART
WD40	2618	2661	1.72e0	SMART
WD40	2677	2716	3.99e-1	SMART
WD40	2760	2798	1.79e-1	SMART
WD40	2801	2840	4.28e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000192145
AA Change: S2448P

PolyPhen 2 Score 0.713 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080
AA Change: S2448P

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	205	377	7.4e-18	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2050	1.5e-92	PFAM
Pfam:PH_BEACH	2068	2172	7.5e-32	PFAM
Beach	2203	2480	2.87e-207	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000194759
AA Change: S2448P

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080
AA Change: S2448P

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	205	377	8.1e-18	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2050	1.6e-92	PFAM
Pfam:PH_BEACH	2068	2172	8.3e-32	PFAM
Beach	2203	2480	2.87e-207	SMART
WD40	2578	2615	7.4e0	SMART
WD40	2618	2661	1.72e0	SMART
WD40	2677	2716	3.99e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195524
AA Change: S352P

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000141734
Gene: ENSMUSG00000028080
AA Change: S352P

Domain	Start	End	E-Value	Type
Pfam:PH_BEACH	3	76	3.6e-20	PFAM
Beach	107	384	2.87e-207	SMART
WD40	482	519	7.4e0	SMART
WD40	522	565	1.72e0	SMART
WD40	581	620	3.99e-1	SMART
WD40	664	702	1.79e-1	SMART
WD40	705	744	4.28e0	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WDL-BEACH-WD (WBW) gene family. Its expression is induced in B cells and macrophages by bacterial lipopolysaccharides (LPS). The encoded protein associates with protein kinase A and may be involved in leading intracellular vesicles to activated receptor complexes, which aids in the secretion and/or membrane deposition of immune effector molecules. Defects in this gene are associated with the disorder common variable immunodeficiency-8 with autoimmunity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased numbers of myeloid-derived suppressor cells and regulatory T cells, abnormal NK cell physiology, impaired rejection of allogeneic, xenogeneic and missing self bone-marrow grafts, and resistance to acute graft vs host disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700027J19Rik	A	G	7: 4,151,483	L102P	probably damaging	Het
1700030K09Rik	A	G	8: 72,445,400	K217R	probably damaging	Het
1810024B03Rik	A	G	2: 127,186,944	Y112H	probably damaging	Het
A430078G23Rik	T	C	8: 3,388,957		probably benign	Het
Acot2	T	C	12: 83,990,613	Y234H	probably benign	Het
Alox12e	C	T	11: 70,321,865	V53I	probably benign	Het
Ankrd50	T	C	3: 38,456,361	H619R	probably damaging	Het
Arfgef3	A	T	10: 18,603,511	L1452Q	probably damaging	Het
Arhgap42	T	C	9: 9,180,033	S82G	possibly damaging	Het
Bicra	C	A	7: 15,972,322	R1398L	probably damaging	Het
Boc	T	C	16: 44,520,234	T118A	probably benign	Het
Btnl9	A	G	11: 49,175,595	Y381H	probably damaging	Het
Cbln3	T	G	14: 55,884,129	E20A	probably benign	Het
Csrnp3	A	G	2: 66,019,543	Y171C	probably benign	Het
Cyp2d9	A	T	15: 82,455,951	I181F	probably damaging	Het
Cyp7b1	T	A	3: 18,096,691	T295S	probably damaging	Het
Dbn1	C	T	13: 55,474,916	E585K	probably damaging	Het
Dok1	A	T	6: 83,031,569	D377E	probably damaging	Het
Eed	A	T	7: 89,971,552	Y87*	probably null	Het
Entpd3	T	C	9: 120,557,421	V156A	probably damaging	Het
Exo5	T	A	4: 120,922,072	T199S	probably damaging	Het
Extl2	T	C	3: 116,024,357	I106T	probably benign	Het
Ezh2	A	G	6: 47,551,726	C291R	probably benign	Het
Flvcr1	A	T	1: 191,011,219	M466K	probably benign	Het
Fras1	G	T	5: 96,691,372	M1583I	probably benign	Het
Fzd9	G	T	5: 135,249,619	R471S	probably damaging	Het
Galr1	A	T	18: 82,405,540	F204Y	probably damaging	Het
Gm38394	A	T	1: 133,658,538	S354T	probably benign	Het
Gna11	A	T	10: 81,530,904	I324N	probably damaging	Het
Gucy1a2	A	G	9: 3,759,484	E430G	possibly damaging	Het
Hhatl	C	T	9: 121,788,762	A254T	probably benign	Het
Ikzf1	A	C	11: 11,769,352	N353T	probably benign	Het
Il7	T	A	3: 7,576,027	T110S	probably damaging	Het
Keg1	A	G	19: 12,711,060	N53D	probably damaging	Het
Klhl21	T	C	4: 152,015,507	I558T	probably damaging	Het
Lca5l	G	A	16: 96,162,653	T357M	probably damaging	Het
Map3k6	T	A	4: 133,248,082	Y709*	probably null	Het
Megf6	A	G	4: 154,267,967	E1261G	probably benign	Het
Mettl3	C	T	14: 52,296,698	G473D	probably damaging	Het
Mga	A	G	2: 119,902,790	I40V	probably damaging	Het
Mmp13	T	A	9: 7,276,602	D232E	probably benign	Het
Nampt	T	C	12: 32,833,101	V95A	probably benign	Het
Nbeal1	T	C	1: 60,247,734	V905A	probably benign	Het
Nomo1	A	T	7: 46,068,698	E840V	possibly damaging	Het
Nprl2	A	T	9: 107,543,298	I101F	probably damaging	Het
Nup160	A	T	2: 90,735,427	I1378F	possibly damaging	Het
Ogdhl	T	C	14: 32,326,979	S69P	probably damaging	Het
Olfr1105	A	T	2: 87,033,445	Y259N	probably damaging	Het
Olfr1240	C	A	2: 89,440,175	V35L	possibly damaging	Het
Olfr1283	A	G	2: 111,369,105	S158G	possibly damaging	Het
Olfr1390	T	A	11: 49,340,673	I47N	possibly damaging	Het
Olfr143	T	C	9: 38,253,864	F149S	probably benign	Het
Olfr870	G	A	9: 20,171,214	A119V	probably damaging	Het
Olfr894	A	G	9: 38,219,455	I211V	probably benign	Het
Osbpl3	C	T	6: 50,348,018	V167I	probably benign	Het
Pclo	T	A	5: 14,713,022	H3836Q	unknown	Het
Prkcg	A	T	7: 3,304,304		probably null	Het
Ror1	A	T	4: 100,412,000	H345L	possibly damaging	Het
Slc36a2	C	T	11: 55,181,544		probably null	Het
Slc40a1	G	A	1: 45,911,374	P306L	possibly damaging	Het
Slc9a8	C	A	2: 167,457,344	T239K	probably benign	Het
Snapc3	A	G	4: 83,450,162	I299V	probably benign	Het
Sp3	G	A	2: 72,971,501	A56V	possibly damaging	Het
Spag17	T	A	3: 100,065,554	S1361T	probably benign	Het
Sptbn2	A	G	19: 4,737,926	T978A	probably benign	Het
Stom	C	A	2: 35,321,632	V126F	probably damaging	Het
Stpg2	A	G	3: 139,218,321	T162A	probably damaging	Het
Stxbp6	G	A	12: 44,902,957	T63M	probably damaging	Het
Tatdn1	A	C	15: 58,921,350	I69S	probably benign	Het
Tbata	A	T	10: 61,180,339	D198V	probably damaging	Het
Tbc1d5	T	C	17: 50,756,705	I638V	probably benign	Het
Tomm70a	A	G	16: 57,149,903	D548G	probably benign	Het
Ust	A	G	10: 8,245,936	F303L	probably damaging	Het
Vps13d	A	G	4: 144,976,560	S4306P	probably benign	Het
Zfp691	A	G	4: 119,170,496	S180P	possibly damaging	Het

Other mutations in Lrba

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Lrba	APN	3	86359782	missense	probably benign	0.00
IGL00788:Lrba	APN	3	86327685	missense	probably damaging	0.97
IGL01139:Lrba	APN	3	86642662	missense	possibly damaging	0.88
IGL01302:Lrba	APN	3	86295400	missense	probably damaging	1.00
IGL01612:Lrba	APN	3	86776177	missense	possibly damaging	0.89
IGL01718:Lrba	APN	3	86351248	missense	probably damaging	1.00
IGL01719:Lrba	APN	3	86327596	splice site	probably benign
IGL01730:Lrba	APN	3	86741424	missense	possibly damaging	0.89
IGL01735:Lrba	APN	3	86327661	missense	probably benign	0.28
IGL01875:Lrba	APN	3	86310047	missense	probably damaging	1.00
IGL01884:Lrba	APN	3	86310412	missense	possibly damaging	0.86
IGL02264:Lrba	APN	3	86780262	missense	probably damaging	0.99
IGL02638:Lrba	APN	3	86325073	missense	probably damaging	0.97
IGL02647:Lrba	APN	3	86359731	missense	probably benign	0.00
IGL02664:Lrba	APN	3	86325731	missense	possibly damaging	0.84
IGL02728:Lrba	APN	3	86776049	missense	probably damaging	0.99
IGL02730:Lrba	APN	3	86328199	missense	probably damaging	1.00
IGL02883:Lrba	APN	3	86354206	missense	probably damaging	1.00
IGL02883:Lrba	APN	3	86445413	missense	probably damaging	0.99
IGL02948:Lrba	APN	3	86310384	splice site	probably null
IGL03090:Lrba	APN	3	86773141	missense	probably benign	0.01
molasses	UTSW	3	86354307	critical splice donor site	probably null
oscar	UTSW	3	86350304	nonsense	probably null
oscar2	UTSW	3	86664458	nonsense	probably null
P0023:Lrba	UTSW	3	86417935	missense	probably damaging	1.00
PIT4802001:Lrba	UTSW	3	86664494	nonsense	probably null
R0077:Lrba	UTSW	3	86542688	missense	probably damaging	0.99
R0189:Lrba	UTSW	3	86368509	missense	probably damaging	1.00
R0217:Lrba	UTSW	3	86642722	missense	probably damaging	1.00
R0349:Lrba	UTSW	3	86540005	missense	probably damaging	1.00
R0396:Lrba	UTSW	3	86295179	missense	probably damaging	1.00
R0536:Lrba	UTSW	3	86715532	missense	probably damaging	1.00
R0712:Lrba	UTSW	3	86297990	nonsense	probably null
R0722:Lrba	UTSW	3	86605989	critical splice donor site	probably null
R0828:Lrba	UTSW	3	86608370	splice site	probably null
R0927:Lrba	UTSW	3	86780233	missense	probably damaging	1.00
R1120:Lrba	UTSW	3	86295192	missense	probably damaging	1.00
R1141:Lrba	UTSW	3	86619558	missense	probably damaging	1.00
R1276:Lrba	UTSW	3	86664526	missense	probably damaging	1.00
R1449:Lrba	UTSW	3	86354278	missense	probably damaging	1.00
R1470:Lrba	UTSW	3	86737142	missense	probably damaging	1.00
R1470:Lrba	UTSW	3	86737142	missense	probably damaging	1.00
R1474:Lrba	UTSW	3	86780266	splice site	probably benign
R1558:Lrba	UTSW	3	86351315	missense	probably damaging	1.00
R1596:Lrba	UTSW	3	86350304	nonsense	probably null
R1652:Lrba	UTSW	3	86539938	missense	probably damaging	1.00
R1800:Lrba	UTSW	3	86351868	missense	probably benign	0.00
R1819:Lrba	UTSW	3	86542634	missense	possibly damaging	0.80
R1862:Lrba	UTSW	3	86773203	critical splice donor site	probably null
R1917:Lrba	UTSW	3	86664501	missense	probably damaging	1.00
R1965:Lrba	UTSW	3	86605868	critical splice acceptor site	probably null
R1966:Lrba	UTSW	3	86605868	critical splice acceptor site	probably null
R1969:Lrba	UTSW	3	86608389	missense	probably damaging	0.99
R2011:Lrba	UTSW	3	86310017	missense	probably damaging	0.99
R2179:Lrba	UTSW	3	86354281	missense	probably damaging	1.00
R2186:Lrba	UTSW	3	86304336	missense	probably damaging	1.00
R2281:Lrba	UTSW	3	86776103	missense	possibly damaging	0.46
R2359:Lrba	UTSW	3	86348750	missense	probably benign	0.01
R2412:Lrba	UTSW	3	86327700	missense	probably damaging	1.00
R2496:Lrba	UTSW	3	86532087	missense	probably damaging	1.00
R3153:Lrba	UTSW	3	86285219	missense	probably damaging	0.99
R3708:Lrba	UTSW	3	86285024	missense	possibly damaging	0.80
R3746:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3747:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3748:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3749:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3750:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3758:Lrba	UTSW	3	86776049	missense	probably damaging	0.99
R3975:Lrba	UTSW	3	86351255	missense	probably damaging	1.00
R4210:Lrba	UTSW	3	86360126	missense	probably damaging	1.00
R4258:Lrba	UTSW	3	86445349	missense	probably damaging	1.00
R4657:Lrba	UTSW	3	86737164	missense	probably damaging	1.00
R4713:Lrba	UTSW	3	86359868	missense	probably benign	0.13
R4716:Lrba	UTSW	3	86642714	missense	probably damaging	0.99
R4811:Lrba	UTSW	3	86776141	missense	probably damaging	1.00
R4827:Lrba	UTSW	3	86360150	missense	possibly damaging	0.85
R4840:Lrba	UTSW	3	86619509	critical splice acceptor site	probably null
R4920:Lrba	UTSW	3	86664458	nonsense	probably null
R4948:Lrba	UTSW	3	86285028	missense	probably damaging	1.00
R4970:Lrba	UTSW	3	86225371	missense	probably benign	0.23
R4985:Lrba	UTSW	3	86327436	splice site	probably null
R4993:Lrba	UTSW	3	86360037	missense	probably damaging	1.00
R5107:Lrba	UTSW	3	86359779	missense	possibly damaging	0.47
R5112:Lrba	UTSW	3	86225371	missense	probably benign	0.23
R5122:Lrba	UTSW	3	86349154	nonsense	probably null
R5155:Lrba	UTSW	3	86351300	missense	probably benign	0.25
R5194:Lrba	UTSW	3	86328219	missense	probably damaging	1.00
R5280:Lrba	UTSW	3	86325022	missense	possibly damaging	0.94
R5445:Lrba	UTSW	3	86368595	missense	probably benign
R5469:Lrba	UTSW	3	86542641	missense	probably damaging	1.00
R5513:Lrba	UTSW	3	86542641	missense	probably damaging	1.00
R5578:Lrba	UTSW	3	86757507	missense	probably benign	0.27
R5740:Lrba	UTSW	3	86328342	missense	probably damaging	1.00
R5868:Lrba	UTSW	3	86319604	missense	probably damaging	1.00
R6104:Lrba	UTSW	3	86353792	missense	probably damaging	1.00
R6166:Lrba	UTSW	3	86354307	critical splice donor site	probably null
R6279:Lrba	UTSW	3	86348864	missense	probably benign	0.26
R6330:Lrba	UTSW	3	86348357	missense	probably benign	0.07
R6367:Lrba	UTSW	3	86368562	missense	probably benign	0.42
R6571:Lrba	UTSW	3	86360060	missense	probably damaging	1.00
R6584:Lrba	UTSW	3	86664576	missense	probably damaging	1.00
R6698:Lrba	UTSW	3	86304425	missense	probably damaging	0.99
R6763:Lrba	UTSW	3	86354263	missense	probably damaging	1.00
R6834:Lrba	UTSW	3	86350286	missense	probably benign	0.00
R6951:Lrba	UTSW	3	86745873	missense	probably benign	0.01
R6969:Lrba	UTSW	3	86619590	missense	probably benign	0.21
R7045:Lrba	UTSW	3	86285091	missense	probably benign	0.03
R7133:Lrba	UTSW	3	86394931	splice site	probably null
R7182:Lrba	UTSW	3	86741458	frame shift	probably null
R7214:Lrba	UTSW	3	86328326	missense	probably damaging	1.00
R7224:Lrba	UTSW	3	86395246	missense	probably damaging	1.00
R7243:Lrba	UTSW	3	86751516	splice site	probably null
R7350:Lrba	UTSW	3	86351902	missense	probably damaging	0.96
R7380:Lrba	UTSW	3	86325074	missense	probably damaging	1.00
R7492:Lrba	UTSW	3	86664528	missense	probably damaging	1.00
R7651:Lrba	UTSW	3	86741466	nonsense	probably null
R7729:Lrba	UTSW	3	86318167	missense	probably damaging	1.00
R7754:Lrba	UTSW	3	86445397	missense	probably damaging	1.00
R7762:Lrba	UTSW	3	86532201	missense	probably damaging	0.99
R7855:Lrba	UTSW	3	86315430	missense	possibly damaging	0.94
R7867:Lrba	UTSW	3	86368589	missense	probably damaging	1.00
R7912:Lrba	UTSW	3	86715565	missense	probably damaging	1.00
R7995:Lrba	UTSW	3	86619551	missense	probably damaging	1.00
R8013:Lrba	UTSW	3	86417971	missense	probably damaging	1.00
R8014:Lrba	UTSW	3	86417971	missense	probably damaging	1.00
R8024:Lrba	UTSW	3	86295401	nonsense	probably null
R8027:Lrba	UTSW	3	86417912	missense	probably benign	0.05
R8090:Lrba	UTSW	3	86348489	missense	probably benign
R8111:Lrba	UTSW	3	86327705	missense	probably damaging	1.00
R8118:Lrba	UTSW	3	86354226	missense	probably benign
R8204:Lrba	UTSW	3	86315403	missense	possibly damaging	0.95
R8239:Lrba	UTSW	3	86542575	missense	probably damaging	1.00
R8509:Lrba	UTSW	3	86348176	missense	probably benign	0.04
R8532:Lrba	UTSW	3	86757483	missense	probably damaging	1.00
R8726:Lrba	UTSW	3	86353755	missense	probably benign
R8744:Lrba	UTSW	3	86304333	missense	probably benign	0.08
R8782:Lrba	UTSW	3	86642669	missense	probably benign	0.00
R8784:Lrba	UTSW	3	86375928	missense	probably damaging	1.00
R8922:Lrba	UTSW	3	86356666	missense	probably damaging	1.00
R8964:Lrba	UTSW	3	86351245	missense	probably benign	0.22
R8971:Lrba	UTSW	3	86615081	missense	probably benign	0.00
R9046:Lrba	UTSW	3	86395236	missense	possibly damaging	0.94
R9155:Lrba	UTSW	3	86295201	missense	probably damaging	1.00
R9236:Lrba	UTSW	3	86353759	missense	probably benign	0.05
R9266:Lrba	UTSW	3	86291467	missense	probably benign	0.08
R9297:Lrba	UTSW	3	86373566	missense	probably damaging	1.00
R9404:Lrba	UTSW	3	86297917	missense	probably damaging	0.99
R9617:Lrba	UTSW	3	86359862	missense	probably benign
R9640:Lrba	UTSW	3	86619568	nonsense	probably null
R9779:Lrba	UTSW	3	86325771	missense	probably damaging	1.00
X0065:Lrba	UTSW	3	86297899	missense	probably damaging	1.00
X0065:Lrba	UTSW	3	86325089	missense	possibly damaging	0.95
Z1176:Lrba	UTSW	3	86715538	missense	probably benign	0.31
Z1176:Lrba	UTSW	3	86751532	missense	possibly damaging	0.85
Z1177:Lrba	UTSW	3	86540049	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCAAACTCTTGTTGCGTTGC -3'
(R):5'- AACTGAGGAACAGCTTGACCTGC -3'

Sequencing Primer
(F):5'- ttctcctgccttggcttc -3'
(R):5'- AACAGCTTGACCTGCTTTGG -3'

Posted On

2013-05-23