Incidental Mutation 'R5273:Bhmt2'
ID403780
Institutional Source Beutler Lab
Gene Symbol Bhmt2
Ensembl Gene ENSMUSG00000042118
Gene Namebetaine-homocysteine methyltransferase 2
SynonymsC81077, D13Ucla2
MMRRC Submission 042862-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5273 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location93655720-93674302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93666578 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 149 (A149V)
Ref Sequence ENSEMBL: ENSMUSP00000015941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015941]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015941
AA Change: A149V

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000015941
Gene: ENSMUSG00000042118
AA Change: A149V

DomainStartEndE-ValueType
Pfam:S-methyl_trans 23 305 3.9e-44 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homocysteine is a sulfur-containing amino acid that plays a crucial role in methylation reactions. Transfer of the methyl group from betaine to homocysteine creates methionine, which donates the methyl group to methylate DNA, proteins, lipids, and other intracellular metabolites. The protein encoded by this gene is one of two methyl transferases that can catalyze the transfer of the methyl group from betaine to homocysteine. Anomalies in homocysteine metabolism have been implicated in disorders ranging from vascular disease to neural tube birth defects such as spina bifida. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,341 S2603P probably damaging Het
2410089E03Rik T C 15: 8,262,938 S3012P unknown Het
Abcc4 T C 14: 118,594,821 N799S possibly damaging Het
Arhgap20 A G 9: 51,848,616 N589S probably damaging Het
Armc10 C T 5: 21,653,428 A157V possibly damaging Het
Atp2b2 A G 6: 113,759,232 L958P probably damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Ccdc7a CATCAGCTGATAT CAT 8: 129,061,609 probably null Het
Cntnap4 A G 8: 112,733,438 D141G probably damaging Het
Dis3 A G 14: 99,098,806 V88A probably benign Het
Dnajc21 A T 15: 10,454,807 C316S probably damaging Het
Dnhd1 A G 7: 105,714,482 T4084A probably damaging Het
Dock3 A C 9: 106,900,705 probably null Het
Eml5 T C 12: 98,790,688 H1894R probably damaging Het
Galc T C 12: 98,252,071 Y174C probably damaging Het
Gm4841 C T 18: 60,270,743 V93I probably benign Het
Gm7995 T C 14: 42,311,456 Y98H probably damaging Het
Gnrhr T A 5: 86,182,246 H305L possibly damaging Het
Gpr179 A T 11: 97,347,430 F323I probably damaging Het
Kdm6b G T 11: 69,404,201 P1080Q unknown Het
Man2a1 C T 17: 64,733,785 T126I probably damaging Het
Mdm4 G A 1: 132,994,582 T274M probably benign Het
Mug1 T A 6: 121,873,789 V748E probably damaging Het
Nav3 A T 10: 109,693,038 probably null Het
Olfr957 A G 9: 39,511,499 S74P possibly damaging Het
Olfr974 T C 9: 39,942,557 V99A probably benign Het
Pcdhb1 T C 18: 37,265,713 V239A probably benign Het
Ppic T A 18: 53,409,258 H126L probably damaging Het
Sdk1 T C 5: 141,998,828 F463L probably damaging Het
Shroom1 A G 11: 53,463,844 E197G possibly damaging Het
Slc22a14 A G 9: 119,170,638 S496P probably benign Het
Slc27a1 G A 8: 71,584,256 G379S probably benign Het
Slco1a5 T C 6: 142,242,098 E505G probably benign Het
Snrpe A C 1: 133,609,780 probably benign Het
Sp100 G T 1: 85,709,104 V299F possibly damaging Het
Stard9 A G 2: 120,705,087 S3942G possibly damaging Het
Ttn A G 2: 76,814,604 V12969A probably damaging Het
Txndc11 T C 16: 11,128,623 Q108R probably benign Het
Wnk4 A T 11: 101,263,869 I295F probably damaging Het
Other mutations in Bhmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Bhmt2 APN 13 93666771 splice site probably benign
IGL01665:Bhmt2 APN 13 93663153 nonsense probably null
IGL02059:Bhmt2 APN 13 93666663 missense probably benign
IGL02239:Bhmt2 APN 13 93663179 missense probably benign 0.00
IGL02267:Bhmt2 APN 13 93669346 missense probably damaging 1.00
IGL03148:Bhmt2 APN 13 93666653 missense possibly damaging 0.48
R1171:Bhmt2 UTSW 13 93662329 missense probably benign 0.00
R1517:Bhmt2 UTSW 13 93662339 missense probably damaging 0.97
R1886:Bhmt2 UTSW 13 93662490 missense probably benign 0.02
R2167:Bhmt2 UTSW 13 93662504 missense probably benign 0.29
R4024:Bhmt2 UTSW 13 93663331 splice site probably benign
R4823:Bhmt2 UTSW 13 93663290 missense probably benign
R5333:Bhmt2 UTSW 13 93671430 missense probably benign 0.00
R5738:Bhmt2 UTSW 13 93663290 missense probably benign
R5955:Bhmt2 UTSW 13 93663197 missense probably benign 0.00
R6281:Bhmt2 UTSW 13 93663160 missense probably damaging 1.00
R6858:Bhmt2 UTSW 13 93671440 missense probably damaging 0.97
R6934:Bhmt2 UTSW 13 93662311 missense probably benign 0.18
R6985:Bhmt2 UTSW 13 93663322 missense possibly damaging 0.64
R7185:Bhmt2 UTSW 13 93663271 missense probably benign 0.22
R7639:Bhmt2 UTSW 13 93663314 missense probably damaging 1.00
R8412:Bhmt2 UTSW 13 93662312 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CCCTAAGTCAGTTACTGCAACC -3'
(R):5'- CTCAGTGGGAAGCTGTGAATG -3'

Sequencing Primer
(F):5'- GTCAGTTACTGCAACCACTTAAAC -3'
(R):5'- TGAATGCAGCTGCCTGTGAC -3'
Posted On2016-07-22