Incidental Mutation 'R5273:Dis3'
ID403783
Institutional Source Beutler Lab
Gene Symbol Dis3
Ensembl Gene ENSMUSG00000033166
Gene NameDIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease
Synonyms2810028N01Rik
MMRRC Submission 042862-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5273 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location99075206-99099770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99098806 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 88 (V88A)
Ref Sequence ENSEMBL: ENSMUSP00000154479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022650] [ENSMUST00000042471] [ENSMUST00000227022] [ENSMUST00000228643]
Predicted Effect probably benign
Transcript: ENSMUST00000022650
SMART Domains Protein: ENSMUSP00000022650
Gene: ENSMUSG00000022064

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
coiled coil region 58 165 N/A INTRINSIC
coiled coil region 200 364 N/A INTRINSIC
coiled coil region 396 444 N/A INTRINSIC
coiled coil region 474 553 N/A INTRINSIC
coiled coil region 586 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042471
AA Change: V88A

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000041906
Gene: ENSMUSG00000033166
AA Change: V88A

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
PINc 64 182 2.8e-24 SMART
low complexity region 425 436 N/A INTRINSIC
RNB 467 797 5.56e-141 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227001
Predicted Effect unknown
Transcript: ENSMUST00000227022
AA Change: S111P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228598
Predicted Effect probably benign
Transcript: ENSMUST00000228643
AA Change: V88A

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,341 S2603P probably damaging Het
2410089E03Rik T C 15: 8,262,938 S3012P unknown Het
Abcc4 T C 14: 118,594,821 N799S possibly damaging Het
Arhgap20 A G 9: 51,848,616 N589S probably damaging Het
Armc10 C T 5: 21,653,428 A157V possibly damaging Het
Atp2b2 A G 6: 113,759,232 L958P probably damaging Het
Bhmt2 G A 13: 93,666,578 A149V possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Ccdc7a CATCAGCTGATAT CAT 8: 129,061,609 probably null Het
Cntnap4 A G 8: 112,733,438 D141G probably damaging Het
Dnajc21 A T 15: 10,454,807 C316S probably damaging Het
Dnhd1 A G 7: 105,714,482 T4084A probably damaging Het
Dock3 A C 9: 106,900,705 probably null Het
Eml5 T C 12: 98,790,688 H1894R probably damaging Het
Galc T C 12: 98,252,071 Y174C probably damaging Het
Gm4841 C T 18: 60,270,743 V93I probably benign Het
Gm7995 T C 14: 42,311,456 Y98H probably damaging Het
Gnrhr T A 5: 86,182,246 H305L possibly damaging Het
Gpr179 A T 11: 97,347,430 F323I probably damaging Het
Kdm6b G T 11: 69,404,201 P1080Q unknown Het
Man2a1 C T 17: 64,733,785 T126I probably damaging Het
Mdm4 G A 1: 132,994,582 T274M probably benign Het
Mug1 T A 6: 121,873,789 V748E probably damaging Het
Nav3 A T 10: 109,693,038 probably null Het
Olfr957 A G 9: 39,511,499 S74P possibly damaging Het
Olfr974 T C 9: 39,942,557 V99A probably benign Het
Pcdhb1 T C 18: 37,265,713 V239A probably benign Het
Ppic T A 18: 53,409,258 H126L probably damaging Het
Sdk1 T C 5: 141,998,828 F463L probably damaging Het
Shroom1 A G 11: 53,463,844 E197G possibly damaging Het
Slc22a14 A G 9: 119,170,638 S496P probably benign Het
Slc27a1 G A 8: 71,584,256 G379S probably benign Het
Slco1a5 T C 6: 142,242,098 E505G probably benign Het
Snrpe A C 1: 133,609,780 probably benign Het
Sp100 G T 1: 85,709,104 V299F possibly damaging Het
Stard9 A G 2: 120,705,087 S3942G possibly damaging Het
Ttn A G 2: 76,814,604 V12969A probably damaging Het
Txndc11 T C 16: 11,128,623 Q108R probably benign Het
Wnk4 A T 11: 101,263,869 I295F probably damaging Het
Other mutations in Dis3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Dis3 APN 14 99082674 missense probably damaging 1.00
IGL00821:Dis3 APN 14 99091486 missense probably benign 0.00
IGL00975:Dis3 APN 14 99079234 missense probably damaging 1.00
IGL01536:Dis3 APN 14 99079423 missense probably damaging 1.00
IGL01538:Dis3 APN 14 99097745 missense probably benign 0.00
IGL02143:Dis3 APN 14 99091318 splice site probably benign
IGL02270:Dis3 APN 14 99078354 missense probably benign 0.01
IGL02354:Dis3 APN 14 99079712 nonsense probably null
IGL02361:Dis3 APN 14 99079712 nonsense probably null
IGL02650:Dis3 APN 14 99098785 missense probably benign 0.00
IGL03053:Dis3 APN 14 99098734 missense probably benign 0.00
IGL03057:Dis3 APN 14 99089990 missense possibly damaging 0.95
IGL03389:Dis3 APN 14 99095347 splice site probably benign
R0415:Dis3 UTSW 14 99087456 missense probably damaging 1.00
R0504:Dis3 UTSW 14 99081390 splice site probably benign
R1535:Dis3 UTSW 14 99079426 missense probably damaging 1.00
R1756:Dis3 UTSW 14 99086103 missense probably damaging 1.00
R1767:Dis3 UTSW 14 99084142 missense probably damaging 1.00
R1883:Dis3 UTSW 14 99091469 missense probably benign 0.21
R1938:Dis3 UTSW 14 99097590 missense probably benign 0.09
R2056:Dis3 UTSW 14 99098815 missense possibly damaging 0.90
R2133:Dis3 UTSW 14 99079877 missense probably benign 0.18
R2448:Dis3 UTSW 14 99087412 missense probably damaging 0.99
R3407:Dis3 UTSW 14 99098776 missense probably benign 0.15
R4052:Dis3 UTSW 14 99095316 missense probably benign 0.00
R4207:Dis3 UTSW 14 99095316 missense probably benign 0.00
R4208:Dis3 UTSW 14 99095316 missense probably benign 0.00
R4465:Dis3 UTSW 14 99084114 missense possibly damaging 0.88
R4612:Dis3 UTSW 14 99091435 missense probably benign 0.07
R4859:Dis3 UTSW 14 99087790 missense probably damaging 1.00
R4932:Dis3 UTSW 14 99088904 missense probably damaging 1.00
R5335:Dis3 UTSW 14 99097653 missense possibly damaging 0.72
R5409:Dis3 UTSW 14 99085932 missense possibly damaging 0.95
R5802:Dis3 UTSW 14 99099664 missense probably damaging 1.00
R6156:Dis3 UTSW 14 99098779 missense probably benign 0.10
R6309:Dis3 UTSW 14 99085922 missense probably benign 0.00
R7275:Dis3 UTSW 14 99087489 missense probably damaging 1.00
R7511:Dis3 UTSW 14 99099606 missense possibly damaging 0.94
R7535:Dis3 UTSW 14 99089979 missense probably benign 0.15
R7794:Dis3 UTSW 14 99098797 missense probably benign 0.04
R8013:Dis3 UTSW 14 99077399 missense possibly damaging 0.50
R8014:Dis3 UTSW 14 99077399 missense possibly damaging 0.50
R8077:Dis3 UTSW 14 99090035 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTCTTCCACACAACCAGG -3'
(R):5'- TTTTCTGCAGCCAAGTACCAC -3'

Sequencing Primer
(F):5'- CAGGAAGCTACAGCCTGTGTTTG -3'
(R):5'- TACCACTTTGGCCTAACGGAGAG -3'
Posted On2016-07-22