Incidental Mutation 'R5273:Txndc11'
ID403788
Institutional Source Beutler Lab
Gene Symbol Txndc11
Ensembl Gene ENSMUSG00000022498
Gene Namethioredoxin domain containing 11
Synonyms2810408E11Rik, EF-hand binding protein 1, Txdc11, EFP1
MMRRC Submission 042862-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R5273 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location11074911-11134650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11128623 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 108 (Q108R)
Ref Sequence ENSEMBL: ENSMUSP00000112601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038424] [ENSMUST00000118362] [ENSMUST00000118679] [ENSMUST00000145225] [ENSMUST00000147884] [ENSMUST00000155221]
Predicted Effect probably benign
Transcript: ENSMUST00000038424
AA Change: Q108R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000041113
Gene: ENSMUSG00000022498
AA Change: Q108R

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 5.8e-11 PFAM
Pfam:Thioredoxin 660 756 1e-11 PFAM
coiled coil region 793 830 N/A INTRINSIC
low complexity region 927 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118362
AA Change: Q108R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113432
Gene: ENSMUSG00000022498
AA Change: Q108R

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 2.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118679
AA Change: Q108R

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112601
Gene: ENSMUSG00000022498
AA Change: Q108R

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 4.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145225
AA Change: Q108R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000116563
Gene: ENSMUSG00000022498
AA Change: Q108R

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 5.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147884
SMART Domains Protein: ENSMUSP00000117426
Gene: ENSMUSG00000022498

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155221
SMART Domains Protein: ENSMUSP00000114777
Gene: ENSMUSG00000022498

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,262,938 S3012P unknown Het
2410089E03Rik T C 15: 8,244,341 S2603P probably damaging Het
Abcc4 T C 14: 118,594,821 N799S possibly damaging Het
Arhgap20 A G 9: 51,848,616 N589S probably damaging Het
Armc10 C T 5: 21,653,428 A157V possibly damaging Het
Atp2b2 A G 6: 113,759,232 L958P probably damaging Het
Bhmt2 G A 13: 93,666,578 A149V possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Ccdc7a CATCAGCTGATAT CAT 8: 129,061,609 probably null Het
Cntnap4 A G 8: 112,733,438 D141G probably damaging Het
Dis3 A G 14: 99,098,806 V88A probably benign Het
Dnajc21 A T 15: 10,454,807 C316S probably damaging Het
Dnhd1 A G 7: 105,714,482 T4084A probably damaging Het
Dock3 A C 9: 106,900,705 probably null Het
Eml5 T C 12: 98,790,688 H1894R probably damaging Het
Galc T C 12: 98,252,071 Y174C probably damaging Het
Gm4841 C T 18: 60,270,743 V93I probably benign Het
Gm7995 T C 14: 42,311,456 Y98H probably damaging Het
Gnrhr T A 5: 86,182,246 H305L possibly damaging Het
Gpr179 A T 11: 97,347,430 F323I probably damaging Het
Kdm6b G T 11: 69,404,201 P1080Q unknown Het
Man2a1 C T 17: 64,733,785 T126I probably damaging Het
Mdm4 G A 1: 132,994,582 T274M probably benign Het
Mug1 T A 6: 121,873,789 V748E probably damaging Het
Nav3 A T 10: 109,693,038 probably null Het
Olfr957 A G 9: 39,511,499 S74P possibly damaging Het
Olfr974 T C 9: 39,942,557 V99A probably benign Het
Pcdhb1 T C 18: 37,265,713 V239A probably benign Het
Ppic T A 18: 53,409,258 H126L probably damaging Het
Sdk1 T C 5: 141,998,828 F463L probably damaging Het
Shroom1 A G 11: 53,463,844 E197G possibly damaging Het
Slc22a14 A G 9: 119,170,638 S496P probably benign Het
Slc27a1 G A 8: 71,584,256 G379S probably benign Het
Slco1a5 T C 6: 142,242,098 E505G probably benign Het
Snrpe A C 1: 133,609,780 probably benign Het
Sp100 G T 1: 85,709,104 V299F possibly damaging Het
Stard9 A G 2: 120,705,087 S3942G possibly damaging Het
Ttn A G 2: 76,814,604 V12969A probably damaging Het
Wnk4 A T 11: 101,263,869 I295F probably damaging Het
Other mutations in Txndc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Txndc11 APN 16 11104632 missense probably damaging 0.96
IGL00563:Txndc11 APN 16 11104632 missense probably damaging 0.96
IGL02576:Txndc11 APN 16 11075017 unclassified probably benign
IGL03070:Txndc11 APN 16 11075287 missense probably damaging 0.97
P0047:Txndc11 UTSW 16 11091797 splice site probably benign
R0091:Txndc11 UTSW 16 11088104 missense probably benign
R0448:Txndc11 UTSW 16 11091761 missense probably damaging 0.99
R0796:Txndc11 UTSW 16 11134474 small deletion probably benign
R0960:Txndc11 UTSW 16 11091589 missense probably benign 0.28
R1184:Txndc11 UTSW 16 11128500 missense probably benign 0.03
R1327:Txndc11 UTSW 16 11116814 missense possibly damaging 0.86
R1441:Txndc11 UTSW 16 11134550 start gained probably benign
R1515:Txndc11 UTSW 16 11075062 missense probably damaging 0.98
R1699:Txndc11 UTSW 16 11087775 critical splice donor site probably null
R1709:Txndc11 UTSW 16 11128701 nonsense probably null
R1850:Txndc11 UTSW 16 11088404 missense probably damaging 0.98
R2026:Txndc11 UTSW 16 11134474 small deletion probably benign
R3433:Txndc11 UTSW 16 11088188 missense probably benign
R4468:Txndc11 UTSW 16 11075223 missense probably benign 0.01
R4469:Txndc11 UTSW 16 11075223 missense probably benign 0.01
R4652:Txndc11 UTSW 16 11075122 missense probably benign
R4675:Txndc11 UTSW 16 11084881 missense possibly damaging 0.65
R4697:Txndc11 UTSW 16 11084314 missense probably damaging 0.99
R4907:Txndc11 UTSW 16 11088534 missense probably benign 0.17
R5205:Txndc11 UTSW 16 11128665 missense probably damaging 0.98
R5865:Txndc11 UTSW 16 11122688 missense probably damaging 1.00
R5873:Txndc11 UTSW 16 11075205 missense probably damaging 1.00
R5941:Txndc11 UTSW 16 11075071 missense probably benign 0.04
R6360:Txndc11 UTSW 16 11084792 missense probably damaging 1.00
R6894:Txndc11 UTSW 16 11088145 missense probably damaging 1.00
R7285:Txndc11 UTSW 16 11084299 missense probably damaging 0.98
R7334:Txndc11 UTSW 16 11128561 missense probably damaging 1.00
R7502:Txndc11 UTSW 16 11087878 missense probably benign 0.08
R7660:Txndc11 UTSW 16 11087929 missense probably damaging 1.00
R7677:Txndc11 UTSW 16 11134474 small deletion probably benign
R7683:Txndc11 UTSW 16 11084235 missense probably damaging 1.00
R8315:Txndc11 UTSW 16 11075601 missense possibly damaging 0.70
X0020:Txndc11 UTSW 16 11084218 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ACTTGACAGTCACCGCTTG -3'
(R):5'- ATCTGTACTGTCCCAGCCAG -3'

Sequencing Primer
(F):5'- CTTGGGTGAAAGCACACA -3'
(R):5'- TACTGTCCCAGCCAGGTGTTG -3'
Posted On2016-07-22