Incidental Mutation 'R5273:Man2a1'
ID403789
Institutional Source Beutler Lab
Gene Symbol Man2a1
Ensembl Gene ENSMUSG00000024085
Gene Namemannosidase 2, alpha 1
SynonymsMana2, Map-2, Mana-2
MMRRC Submission 042862-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R5273 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location64600736-64755110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64733785 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 126 (T126I)
Ref Sequence ENSEMBL: ENSMUSP00000130529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086723] [ENSMUST00000169668]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086723
AA Change: T922I

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083928
Gene: ENSMUSG00000024085
AA Change: T922I

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 45 74 N/A INTRINSIC
Pfam:Glyco_hydro_38 166 496 2.3e-111 PFAM
Alpha-mann_mid 501 587 5.39e-34 SMART
Pfam:Glyco_hydro_38C 648 1144 1.5e-98 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169668
AA Change: T126I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130529
Gene: ENSMUSG00000024085
AA Change: T126I

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38C 1 268 1.6e-50 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl hydrolase that localizes to the Golgi and catalyzes the final hydrolytic step in the asparagine-linked oligosaccharide (N-glycan) maturation pathway. Mutations in the mouse homolog of this gene have been shown to cause a systemic autoimmune disease similar to human systemic lupus erythematosus. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mutation of this gene results in premature death, dyserythropoiesis, systemic autoimmune disease, including an increase in serum immunoglobulins, glomerulonephritis, and hematuria, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,341 S2603P probably damaging Het
2410089E03Rik T C 15: 8,262,938 S3012P unknown Het
Abcc4 T C 14: 118,594,821 N799S possibly damaging Het
Arhgap20 A G 9: 51,848,616 N589S probably damaging Het
Armc10 C T 5: 21,653,428 A157V possibly damaging Het
Atp2b2 A G 6: 113,759,232 L958P probably damaging Het
Bhmt2 G A 13: 93,666,578 A149V possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Ccdc7a CATCAGCTGATAT CAT 8: 129,061,609 probably null Het
Cntnap4 A G 8: 112,733,438 D141G probably damaging Het
Dis3 A G 14: 99,098,806 V88A probably benign Het
Dnajc21 A T 15: 10,454,807 C316S probably damaging Het
Dnhd1 A G 7: 105,714,482 T4084A probably damaging Het
Dock3 A C 9: 106,900,705 probably null Het
Eml5 T C 12: 98,790,688 H1894R probably damaging Het
Galc T C 12: 98,252,071 Y174C probably damaging Het
Gm4841 C T 18: 60,270,743 V93I probably benign Het
Gm7995 T C 14: 42,311,456 Y98H probably damaging Het
Gnrhr T A 5: 86,182,246 H305L possibly damaging Het
Gpr179 A T 11: 97,347,430 F323I probably damaging Het
Kdm6b G T 11: 69,404,201 P1080Q unknown Het
Mdm4 G A 1: 132,994,582 T274M probably benign Het
Mug1 T A 6: 121,873,789 V748E probably damaging Het
Nav3 A T 10: 109,693,038 probably null Het
Olfr957 A G 9: 39,511,499 S74P possibly damaging Het
Olfr974 T C 9: 39,942,557 V99A probably benign Het
Pcdhb1 T C 18: 37,265,713 V239A probably benign Het
Ppic T A 18: 53,409,258 H126L probably damaging Het
Sdk1 T C 5: 141,998,828 F463L probably damaging Het
Shroom1 A G 11: 53,463,844 E197G possibly damaging Het
Slc22a14 A G 9: 119,170,638 S496P probably benign Het
Slc27a1 G A 8: 71,584,256 G379S probably benign Het
Slco1a5 T C 6: 142,242,098 E505G probably benign Het
Snrpe A C 1: 133,609,780 probably benign Het
Sp100 G T 1: 85,709,104 V299F possibly damaging Het
Stard9 A G 2: 120,705,087 S3942G possibly damaging Het
Ttn A G 2: 76,814,604 V12969A probably damaging Het
Txndc11 T C 16: 11,128,623 Q108R probably benign Het
Wnk4 A T 11: 101,263,869 I295F probably damaging Het
Other mutations in Man2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Man2a1 APN 17 64710705 missense probably benign 0.00
IGL01823:Man2a1 APN 17 64666824 missense probably damaging 0.99
IGL02012:Man2a1 APN 17 64666899 missense probably damaging 0.98
IGL02589:Man2a1 APN 17 64679778 missense probably benign 0.01
IGL03248:Man2a1 APN 17 64713611 missense probably damaging 1.00
R0070:Man2a1 UTSW 17 64659079 splice site probably null
R0092:Man2a1 UTSW 17 64659084 splice site probably benign
R1347:Man2a1 UTSW 17 64712450 missense probably damaging 0.98
R1347:Man2a1 UTSW 17 64712450 missense probably damaging 0.98
R1376:Man2a1 UTSW 17 64672043 missense possibly damaging 0.50
R1376:Man2a1 UTSW 17 64672043 missense possibly damaging 0.50
R1599:Man2a1 UTSW 17 64679831 missense possibly damaging 0.80
R1799:Man2a1 UTSW 17 64669497 missense probably damaging 1.00
R1799:Man2a1 UTSW 17 64752457 missense probably benign 0.12
R1822:Man2a1 UTSW 17 64740842 missense probably damaging 1.00
R1958:Man2a1 UTSW 17 64750835 missense probably benign 0.00
R2852:Man2a1 UTSW 17 64713601 missense probably benign 0.00
R4324:Man2a1 UTSW 17 64666793 missense probably benign 0.00
R4582:Man2a1 UTSW 17 64752499 missense probably benign 0.00
R4610:Man2a1 UTSW 17 64712459 missense probably benign
R4803:Man2a1 UTSW 17 64659009 missense probably damaging 1.00
R5072:Man2a1 UTSW 17 64659079 splice site probably null
R5109:Man2a1 UTSW 17 64752448 missense probably benign 0.31
R5223:Man2a1 UTSW 17 64712271 missense probably benign 0.17
R5229:Man2a1 UTSW 17 64710734 missense probably benign 0.00
R5238:Man2a1 UTSW 17 64636507 missense probably damaging 1.00
R5289:Man2a1 UTSW 17 64651227 missense probably damaging 0.99
R5352:Man2a1 UTSW 17 64731246 missense probably damaging 1.00
R5428:Man2a1 UTSW 17 64712300 missense probably benign 0.00
R5898:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5942:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5943:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5963:Man2a1 UTSW 17 64675122 missense probably benign
R5969:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5970:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R6164:Man2a1 UTSW 17 64733724 missense possibly damaging 0.87
R6207:Man2a1 UTSW 17 64713605 missense probably benign 0.02
R6245:Man2a1 UTSW 17 64710826 missense probably damaging 0.97
R6724:Man2a1 UTSW 17 64731269 missense possibly damaging 0.91
R6759:Man2a1 UTSW 17 64625388 missense probably benign 0.00
R6778:Man2a1 UTSW 17 64714635 missense possibly damaging 0.69
R7250:Man2a1 UTSW 17 64636588 missense probably benign 0.00
R7354:Man2a1 UTSW 17 64752544 missense probably damaging 1.00
R7833:Man2a1 UTSW 17 64666751 missense probably damaging 0.99
R7991:Man2a1 UTSW 17 64601776 missense probably benign 0.28
R8489:Man2a1 UTSW 17 64601770 missense possibly damaging 0.64
R8540:Man2a1 UTSW 17 64658987 missense probably benign
R8894:Man2a1 UTSW 17 64713601 missense probably benign 0.00
RF007:Man2a1 UTSW 17 64712253 missense probably damaging 0.98
Z1177:Man2a1 UTSW 17 64659020 missense probably damaging 1.00
Z1177:Man2a1 UTSW 17 64735054 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTTGCTTAAACAAGAACAGCAACG -3'
(R):5'- AGGCCTGTGTTAACTACTTGTC -3'

Sequencing Primer
(F):5'- GATGCCCTTCCTCTTTGGGAAAG -3'
(R):5'- TTGTCTCATTCTTAAGGTATAGCAAC -3'
Posted On2016-07-22