Incidental Mutation 'R5274:Col24a1'
ID 403805
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Name collagen, type XXIV, alpha 1
Synonyms 5430404K19Rik
MMRRC Submission 042837-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5274 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 144998233-145257766 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 145190433 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1239 (E1239D)
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848]
AlphaFold Q30D77
Predicted Effect probably benign
Transcript: ENSMUST00000029848
AA Change: E1239D

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: E1239D

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 98.0%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,092,856 (GRCm39) R155H probably benign Het
Ace T C 11: 105,858,863 (GRCm39) M19T probably benign Het
Agl A G 3: 116,566,135 (GRCm39) L995P probably damaging Het
AY761185 T C 8: 21,433,889 (GRCm39) N90S unknown Het
Brca2 T C 5: 150,463,154 (GRCm39) S973P probably benign Het
Cacna1e T C 1: 154,576,250 (GRCm39) T66A probably damaging Het
Cbarp T C 10: 79,967,649 (GRCm39) S531G possibly damaging Het
Cby2 A G 14: 75,820,666 (GRCm39) V362A probably benign Het
Cd96 G T 16: 45,890,066 (GRCm39) T319K possibly damaging Het
Ceacam23 T C 7: 17,649,642 (GRCm39) probably null Het
Chil5 A C 3: 105,936,169 (GRCm39) F41C probably damaging Het
Dip2b A G 15: 100,109,985 (GRCm39) E1490G possibly damaging Het
Dync1li1 T C 9: 114,544,273 (GRCm39) V315A possibly damaging Het
Dync2h1 T C 9: 7,116,540 (GRCm39) S99G probably benign Het
Dynlt5 A T 4: 102,859,768 (GRCm39) T103S possibly damaging Het
E2f8 C T 7: 48,516,925 (GRCm39) R818H probably damaging Het
Eomes T C 9: 118,309,597 (GRCm39) V250A probably damaging Het
Esyt3 T C 9: 99,200,350 (GRCm39) T615A probably benign Het
Fbxo38 A T 18: 62,648,140 (GRCm39) D799E probably damaging Het
Fdft1 A G 14: 63,389,792 (GRCm39) F288S probably damaging Het
Gm14325 G A 2: 177,474,777 (GRCm39) H102Y possibly damaging Het
Gm4871 C G 5: 144,967,180 (GRCm39) E185Q probably damaging Het
Gm5901 C A 7: 105,026,655 (GRCm39) P141Q probably damaging Het
Herc1 T A 9: 66,306,691 (GRCm39) I933N probably benign Het
Ifih1 T C 2: 62,442,062 (GRCm39) Q385R probably benign Het
Ighmbp2 T C 19: 3,315,518 (GRCm39) E634G probably damaging Het
Klk6 C G 7: 43,478,553 (GRCm39) probably null Het
Kmt2d A G 15: 98,752,111 (GRCm39) probably benign Het
Lig3 T A 11: 82,688,118 (GRCm39) probably null Het
Lrp1b T C 2: 41,234,456 (GRCm39) D310G probably null Het
Mroh6 A G 15: 75,756,849 (GRCm39) V571A possibly damaging Het
Olfm5 A G 7: 103,809,190 (GRCm39) S132P probably damaging Het
Or52n20 T C 7: 104,320,733 (GRCm39) S275P probably damaging Het
Or5p64 A T 7: 107,854,842 (GRCm39) F168I probably benign Het
Pacc1 T C 1: 191,080,665 (GRCm39) V295A probably damaging Het
Patj G C 4: 98,407,218 (GRCm39) S4T probably damaging Het
Pcdhga12 T A 18: 37,899,475 (GRCm39) C102* probably null Het
Pik3ap1 T C 19: 41,270,391 (GRCm39) D766G possibly damaging Het
Plch2 A T 4: 155,083,411 (GRCm39) L408Q probably damaging Het
Pnma2 G T 14: 67,154,209 (GRCm39) R211L probably damaging Het
Prkg2 T A 5: 99,117,850 (GRCm39) H468L probably damaging Het
Rad1 T A 15: 10,488,059 (GRCm39) probably null Het
Rims3 A G 4: 120,748,571 (GRCm39) D264G probably damaging Het
Rnf123 AT ATT 9: 107,941,202 (GRCm39) probably null Het
Rrm2 T A 12: 24,760,406 (GRCm39) Y75* probably null Het
Sall3 T C 18: 81,013,052 (GRCm39) N1128S probably benign Het
Slc26a5 T C 5: 22,018,899 (GRCm39) T610A possibly damaging Het
Snx29 G T 16: 11,556,268 (GRCm39) E766D probably damaging Het
Sox17 A G 1: 4,562,111 (GRCm39) V298A possibly damaging Het
Ss18 G A 18: 14,774,106 (GRCm39) Q228* probably null Het
Tas2r121 A G 6: 132,677,811 (GRCm39) S54P probably damaging Het
Ttc21b T C 2: 66,066,627 (GRCm39) E342G possibly damaging Het
Ubap2l A G 3: 89,920,037 (GRCm39) Y818H probably damaging Het
Usp15 C A 10: 123,004,256 (GRCm39) R166I probably damaging Het
Vmn1r34 T G 6: 66,614,123 (GRCm39) H205P probably damaging Het
Vmn2r22 A T 6: 123,627,593 (GRCm39) M1K probably null Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Zdhhc1 T C 8: 106,210,402 (GRCm39) N5S probably benign Het
Zfp758 T A 17: 22,594,836 (GRCm39) C441S probably benign Het
Zp2 T C 7: 119,737,315 (GRCm39) E291G possibly damaging Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145,068,064 (GRCm39) missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145,167,225 (GRCm39) missense probably benign 0.00
IGL01160:Col24a1 APN 3 145,213,468 (GRCm39) missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145,020,637 (GRCm39) missense probably benign 0.07
IGL01409:Col24a1 APN 3 145,244,319 (GRCm39) missense probably benign 0.19
IGL01587:Col24a1 APN 3 145,139,110 (GRCm39) splice site probably null
IGL01666:Col24a1 APN 3 145,050,447 (GRCm39) missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145,230,018 (GRCm39) splice site probably benign
IGL01721:Col24a1 APN 3 145,244,322 (GRCm39) missense probably benign 0.26
IGL01939:Col24a1 APN 3 145,021,005 (GRCm39) missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145,229,922 (GRCm39) splice site probably null
IGL02002:Col24a1 APN 3 145,062,699 (GRCm39) missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145,020,723 (GRCm39) missense probably benign 0.34
IGL02552:Col24a1 APN 3 145,179,962 (GRCm39) missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145,019,934 (GRCm39) missense probably benign
IGL02582:Col24a1 APN 3 145,020,247 (GRCm39) missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145,198,056 (GRCm39) nonsense probably null
IGL02942:Col24a1 APN 3 145,247,420 (GRCm39) missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145,244,458 (GRCm39) critical splice donor site probably null
IGL03108:Col24a1 APN 3 145,029,162 (GRCm39) missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145,019,744 (GRCm39) splice site probably benign
IGL03405:Col24a1 APN 3 145,020,918 (GRCm39) missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145,229,897 (GRCm39) missense possibly damaging 0.94
R0502:Col24a1 UTSW 3 145,251,071 (GRCm39) splice site probably benign
R0556:Col24a1 UTSW 3 145,020,489 (GRCm39) missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 144,998,906 (GRCm39) missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145,019,881 (GRCm39) missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145,034,520 (GRCm39) missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145,166,593 (GRCm39) missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145,095,355 (GRCm39) critical splice donor site probably null
R1713:Col24a1 UTSW 3 145,072,624 (GRCm39) nonsense probably null
R1854:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145,243,022 (GRCm39) critical splice donor site probably null
R1969:Col24a1 UTSW 3 145,020,691 (GRCm39) missense probably benign 0.03
R2216:Col24a1 UTSW 3 145,020,742 (GRCm39) missense probably benign 0.34
R2290:Col24a1 UTSW 3 145,218,950 (GRCm39) missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145,043,621 (GRCm39) missense probably benign 0.01
R3772:Col24a1 UTSW 3 145,251,041 (GRCm39) missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145,167,192 (GRCm39) missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145,230,037 (GRCm39) nonsense probably null
R4433:Col24a1 UTSW 3 145,020,144 (GRCm39) missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145,020,144 (GRCm39) missense probably benign 0.00
R4972:Col24a1 UTSW 3 145,215,439 (GRCm39) missense probably benign 0.42
R5157:Col24a1 UTSW 3 145,051,712 (GRCm39) nonsense probably null
R5216:Col24a1 UTSW 3 145,021,071 (GRCm39) missense possibly damaging 0.85
R5334:Col24a1 UTSW 3 145,167,280 (GRCm39) missense possibly damaging 0.91
R5416:Col24a1 UTSW 3 145,020,786 (GRCm39) nonsense probably null
R5473:Col24a1 UTSW 3 145,243,016 (GRCm39) missense probably benign 0.41
R5538:Col24a1 UTSW 3 144,998,882 (GRCm39) missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145,004,588 (GRCm39) missense probably benign 0.26
R5648:Col24a1 UTSW 3 145,064,321 (GRCm39) missense probably benign 0.00
R5920:Col24a1 UTSW 3 145,133,985 (GRCm39) missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6151:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145,020,141 (GRCm39) missense probably benign 0.00
R6728:Col24a1 UTSW 3 145,020,957 (GRCm39) missense probably benign
R6734:Col24a1 UTSW 3 145,214,429 (GRCm39) missense probably benign 0.06
R6861:Col24a1 UTSW 3 145,166,589 (GRCm39) missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145,020,807 (GRCm39) nonsense probably null
R7001:Col24a1 UTSW 3 145,004,627 (GRCm39) missense probably benign 0.28
R7148:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145,192,059 (GRCm39) nonsense probably null
R7315:Col24a1 UTSW 3 145,137,625 (GRCm39) missense possibly damaging 0.82
R7358:Col24a1 UTSW 3 144,998,926 (GRCm39) critical splice donor site probably null
R7371:Col24a1 UTSW 3 145,049,459 (GRCm39) missense probably benign 0.06
R7383:Col24a1 UTSW 3 145,004,599 (GRCm39) missense probably benign
R7605:Col24a1 UTSW 3 145,244,442 (GRCm39) missense possibly damaging 0.67
R7650:Col24a1 UTSW 3 145,020,214 (GRCm39) missense probably benign 0.00
R7679:Col24a1 UTSW 3 145,105,110 (GRCm39) missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145,072,656 (GRCm39) splice site probably null
R7701:Col24a1 UTSW 3 145,020,772 (GRCm39) missense probably benign
R7805:Col24a1 UTSW 3 145,019,901 (GRCm39) missense probably benign 0.02
R7913:Col24a1 UTSW 3 145,137,621 (GRCm39) nonsense probably null
R7921:Col24a1 UTSW 3 145,179,993 (GRCm39) missense probably damaging 1.00
R8056:Col24a1 UTSW 3 145,019,925 (GRCm39) missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145,213,457 (GRCm39) missense probably benign 0.31
R8294:Col24a1 UTSW 3 145,186,844 (GRCm39) missense probably null 1.00
R8305:Col24a1 UTSW 3 145,179,937 (GRCm39) missense probably benign 0.00
R8430:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R8708:Col24a1 UTSW 3 145,251,020 (GRCm39) missense probably damaging 0.99
R8880:Col24a1 UTSW 3 145,019,798 (GRCm39) missense probably null
R9056:Col24a1 UTSW 3 145,021,009 (GRCm39) missense probably damaging 0.96
R9461:Col24a1 UTSW 3 145,186,879 (GRCm39) nonsense probably null
R9612:Col24a1 UTSW 3 145,250,960 (GRCm39) missense probably benign 0.32
R9777:Col24a1 UTSW 3 145,021,103 (GRCm39) nonsense probably null
Z1176:Col24a1 UTSW 3 145,048,259 (GRCm39) missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145,048,260 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTGACATGTAGCAGGCTTAAAG -3'
(R):5'- TCAGCGTGATGTGATGCGAG -3'

Sequencing Primer
(F):5'- AGAAGCTACTATACCTTGGCAG -3'
(R):5'- TCATAAGACTGAAGTGACAGGGAAC -3'
Posted On 2016-07-22