Mutagenetix > Incidental Mutation

Incidental Mutation 'R5274:Col24a1'

403805

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

042837-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5274 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 145484678 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 1239 (E1239D)

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848]

AlphaFold

Q30D77

Predicted Effect

probably benign
Transcript: ENSMUST00000029848
AA Change: E1239D

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: E1239D

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 98.0%
20x: 96.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921539E11Rik	C	T	4: 103,235,659	R155H	probably benign	Het
Ace	T	C	11: 105,968,037	M19T	probably benign	Het
Agl	A	G	3: 116,772,486	L995P	probably damaging	Het
AY761185	T	C	8: 20,943,873	N90S	unknown	Het
Brca2	T	C	5: 150,539,689	S973P	probably benign	Het
Cacna1e	T	C	1: 154,700,504	T66A	probably damaging	Het
Cbarp	T	C	10: 80,131,815	S531G	possibly damaging	Het
Cd96	G	T	16: 46,069,703	T319K	possibly damaging	Het
Chil5	A	C	3: 106,028,853	F41C	probably damaging	Het
Dip2b	A	G	15: 100,212,104	E1490G	possibly damaging	Het
Dync1li1	T	C	9: 114,715,205	V315A	possibly damaging	Het
Dync2h1	T	C	9: 7,116,540	S99G	probably benign	Het
E2f8	C	T	7: 48,867,177	R818H	probably damaging	Het
Eomes	T	C	9: 118,480,529	V250A	probably damaging	Het
Esyt3	T	C	9: 99,318,297	T615A	probably benign	Het
Fbxo38	A	T	18: 62,515,069	D799E	probably damaging	Het
Fdft1	A	G	14: 63,152,343	F288S	probably damaging	Het
Gm14325	G	A	2: 177,832,984	H102Y	possibly damaging	Het
Gm4871	C	G	5: 145,030,370	E185Q	probably damaging	Het
Gm5155	T	C	7: 17,915,717		probably null	Het
Gm5901	C	A	7: 105,377,448	P141Q	probably damaging	Het
Herc1	T	A	9: 66,399,409	I933N	probably benign	Het
Ifih1	T	C	2: 62,611,718	Q385R	probably benign	Het
Ighmbp2	T	C	19: 3,265,518	E634G	probably damaging	Het
Klk6	C	G	7: 43,829,129		probably null	Het
Kmt2d	A	G	15: 98,854,230		probably benign	Het
Lig3	T	A	11: 82,797,292		probably null	Het
Lrp1b	T	C	2: 41,344,444	D310G	probably null	Het
Mroh6	A	G	15: 75,885,000	V571A	possibly damaging	Het
Olfm5	A	G	7: 104,159,983	S132P	probably damaging	Het
Olfr488	A	T	7: 108,255,635	F168I	probably benign	Het
Olfr659	T	C	7: 104,671,526	S275P	probably damaging	Het
Patj	G	C	4: 98,518,981	S4T	probably damaging	Het
Pcdhga12	T	A	18: 37,766,422	C102*	probably null	Het
Pik3ap1	T	C	19: 41,281,952	D766G	possibly damaging	Het
Plch2	A	T	4: 154,998,954	L408Q	probably damaging	Het
Pnma2	G	T	14: 66,916,760	R211L	probably damaging	Het
Prkg2	T	A	5: 98,969,991	H468L	probably damaging	Het
Rad1	T	A	15: 10,487,973		probably null	Het
Rims3	A	G	4: 120,891,374	D264G	probably damaging	Het
Rnf123	AT	ATT	9: 108,064,003		probably null	Het
Rrm2	T	A	12: 24,710,407	Y75*	probably null	Het
Sall3	T	C	18: 80,969,837	N1128S	probably benign	Het
Slc26a5	T	C	5: 21,813,901	T610A	possibly damaging	Het
Snx29	G	T	16: 11,738,404	E766D	probably damaging	Het
Sox17	A	G	1: 4,491,888	V298A	possibly damaging	Het
Spert	A	G	14: 75,583,226	V362A	probably benign	Het
Ss18	G	A	18: 14,641,049	Q228*	probably null	Het
Tas2r121	A	G	6: 132,700,848	S54P	probably damaging	Het
Tctex1d1	A	T	4: 103,002,571	T103S	possibly damaging	Het
Tmem206	T	C	1: 191,348,468	V295A	probably damaging	Het
Ttc21b	T	C	2: 66,236,283	E342G	possibly damaging	Het
Ubap2l	A	G	3: 90,012,730	Y818H	probably damaging	Het
Usp15	C	A	10: 123,168,351	R166I	probably damaging	Het
Vmn1r34	T	G	6: 66,637,139	H205P	probably damaging	Het
Vmn2r22	A	T	6: 123,650,634	M1K	probably null	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Zdhhc1	T	C	8: 105,483,770	N5S	probably benign	Het
Zfp758	T	A	17: 22,375,855	C441S	probably benign	Het
Zp2	T	C	7: 120,138,092	E291G	possibly damaging	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGTGACATGTAGCAGGCTTAAAG -3'
(R):5'- TCAGCGTGATGTGATGCGAG -3'

Sequencing Primer
(F):5'- AGAAGCTACTATACCTTGGCAG -3'
(R):5'- TCATAAGACTGAAGTGACAGGGAAC -3'

Posted On

2016-07-22