Mutagenetix > Incidental Mutation

Incidental Mutation 'R5274:Patj'

403806

Institutional Source

Beutler Lab

Gene Symbol

Patj

Ensembl Gene

ENSMUSG00000061859

Gene Name

PATJ, crumbs cell polarity complex component

Synonyms

Inadl, Cipp

MMRRC Submission

042837-MU

Accession Numbers

Genbank: NM_172696; MGI: 1277960

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5274 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98395785-98719603 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 98518981 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 4 (S4T)

Ref Sequence

ENSEMBL: ENSMUSP00000115936 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041284] [ENSMUST00000107029] [ENSMUST00000107033] [ENSMUST00000107034] [ENSMUST00000134901]

AlphaFold

Q63ZW7

Predicted Effect

probably damaging
Transcript: ENSMUST00000041284
AA Change: S1067T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000049176
Gene: ENSMUSG00000061859
AA Change: S1067T

Domain	Start	End	E-Value	Type
L27	8	68	6.53e-9	SMART
PDZ	143	221	1.78e-20	SMART
PDZ	256	328	1.15e-23	SMART
PDZ	374	453	3.15e-21	SMART
coiled coil region	486	513	N/A	INTRINSIC
PDZ	570	641	1.28e-12	SMART
PDZ	696	775	9.5e-16	SMART
low complexity region	980	991	N/A	INTRINSIC
low complexity region	1054	1062	N/A	INTRINSIC
PDZ	1083	1166	8.65e-19	SMART
PDZ	1253	1328	6.12e-19	SMART
low complexity region	1356	1366	N/A	INTRINSIC
low complexity region	1410	1428	N/A	INTRINSIC
PDZ	1480	1555	4.36e-24	SMART
PDZ	1577	1650	2.49e-19	SMART
PDZ	1718	1795	2.13e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107029
AA Change: S494T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000102644
Gene: ENSMUSG00000061859
AA Change: S494T

Domain	Start	End	E-Value	Type
PDZ	1	68	1e-9	SMART
PDZ	123	202	4.7e-18	SMART
low complexity region	407	418	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC
PDZ	510	593	4.3e-21	SMART
PDZ	680	755	2.9e-21	SMART
low complexity region	783	793	N/A	INTRINSIC
low complexity region	837	855	N/A	INTRINSIC
PDZ	907	982	2.2e-26	SMART
PDZ	1004	1077	1.2e-21	SMART
PDZ	1145	1222	1e-20	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000107033
AA Change: S735T

SMART Domains

Protein: ENSMUSP00000102648
Gene: ENSMUSG00000061859
AA Change: S735T

Domain	Start	End	E-Value	Type
L27	8	68	6.53e-9	SMART
PDZ	143	221	1.78e-20	SMART
PDZ	256	328	1.15e-23	SMART
PDZ	374	453	3.15e-21	SMART
coiled coil region	486	513	N/A	INTRINSIC
low complexity region	648	659	N/A	INTRINSIC
low complexity region	722	730	N/A	INTRINSIC
PDZ	751	834	8.65e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107034
AA Change: S1063T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102649
Gene: ENSMUSG00000061859
AA Change: S1063T

Domain	Start	End	E-Value	Type
L27	8	68	6.53e-9	SMART
PDZ	143	221	1.78e-20	SMART
PDZ	256	328	1.15e-23	SMART
PDZ	374	453	3.15e-21	SMART
coiled coil region	486	513	N/A	INTRINSIC
PDZ	566	637	1.28e-12	SMART
PDZ	692	771	9.5e-16	SMART
low complexity region	976	987	N/A	INTRINSIC
low complexity region	1050	1058	N/A	INTRINSIC
PDZ	1079	1162	8.65e-19	SMART
PDZ	1249	1324	6.12e-19	SMART
low complexity region	1352	1362	N/A	INTRINSIC
low complexity region	1382	1400	N/A	INTRINSIC
PDZ	1452	1499	7.78e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000134901
AA Change: S4T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000115936
Gene: ENSMUSG00000061859
AA Change: S4T

Domain	Start	End	E-Value	Type
PDZ	20	103	8.65e-19	SMART

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 98.0%
20x: 96.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a multivalent PDZ domain protein, which is expressed exclusively in brain and kidney. This protein selectively interacts with inward rectifier K+ (Kir) family members, N-methyl-D-aspartate receptor subunits, neurexins and neuroligins, as well as cell surface molecules enriched in synaptic membranes. Thus, this protein may serve as a scaffold that brings structurally diverse but functionally connected proteins into close proximity at the synapse. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921539E11Rik	C	T	4: 103,235,659	R155H	probably benign	Het
Ace	T	C	11: 105,968,037	M19T	probably benign	Het
Agl	A	G	3: 116,772,486	L995P	probably damaging	Het
AY761185	T	C	8: 20,943,873	N90S	unknown	Het
Brca2	T	C	5: 150,539,689	S973P	probably benign	Het
Cacna1e	T	C	1: 154,700,504	T66A	probably damaging	Het
Cbarp	T	C	10: 80,131,815	S531G	possibly damaging	Het
Cd96	G	T	16: 46,069,703	T319K	possibly damaging	Het
Chil5	A	C	3: 106,028,853	F41C	probably damaging	Het
Col24a1	A	C	3: 145,484,678	E1239D	probably benign	Het
Dip2b	A	G	15: 100,212,104	E1490G	possibly damaging	Het
Dync1li1	T	C	9: 114,715,205	V315A	possibly damaging	Het
Dync2h1	T	C	9: 7,116,540	S99G	probably benign	Het
E2f8	C	T	7: 48,867,177	R818H	probably damaging	Het
Eomes	T	C	9: 118,480,529	V250A	probably damaging	Het
Esyt3	T	C	9: 99,318,297	T615A	probably benign	Het
Fbxo38	A	T	18: 62,515,069	D799E	probably damaging	Het
Fdft1	A	G	14: 63,152,343	F288S	probably damaging	Het
Gm14325	G	A	2: 177,832,984	H102Y	possibly damaging	Het
Gm4871	C	G	5: 145,030,370	E185Q	probably damaging	Het
Gm5155	T	C	7: 17,915,717		probably null	Het
Gm5901	C	A	7: 105,377,448	P141Q	probably damaging	Het
Herc1	T	A	9: 66,399,409	I933N	probably benign	Het
Ifih1	T	C	2: 62,611,718	Q385R	probably benign	Het
Ighmbp2	T	C	19: 3,265,518	E634G	probably damaging	Het
Klk6	C	G	7: 43,829,129		probably null	Het
Kmt2d	A	G	15: 98,854,230		probably benign	Het
Lig3	T	A	11: 82,797,292		probably null	Het
Lrp1b	T	C	2: 41,344,444	D310G	probably null	Het
Mroh6	A	G	15: 75,885,000	V571A	possibly damaging	Het
Olfm5	A	G	7: 104,159,983	S132P	probably damaging	Het
Olfr488	A	T	7: 108,255,635	F168I	probably benign	Het
Olfr659	T	C	7: 104,671,526	S275P	probably damaging	Het
Pcdhga12	T	A	18: 37,766,422	C102*	probably null	Het
Pik3ap1	T	C	19: 41,281,952	D766G	possibly damaging	Het
Plch2	A	T	4: 154,998,954	L408Q	probably damaging	Het
Pnma2	G	T	14: 66,916,760	R211L	probably damaging	Het
Prkg2	T	A	5: 98,969,991	H468L	probably damaging	Het
Rad1	T	A	15: 10,487,973		probably null	Het
Rims3	A	G	4: 120,891,374	D264G	probably damaging	Het
Rnf123	AT	ATT	9: 108,064,003		probably null	Het
Rrm2	T	A	12: 24,710,407	Y75*	probably null	Het
Sall3	T	C	18: 80,969,837	N1128S	probably benign	Het
Slc26a5	T	C	5: 21,813,901	T610A	possibly damaging	Het
Snx29	G	T	16: 11,738,404	E766D	probably damaging	Het
Sox17	A	G	1: 4,491,888	V298A	possibly damaging	Het
Spert	A	G	14: 75,583,226	V362A	probably benign	Het
Ss18	G	A	18: 14,641,049	Q228*	probably null	Het
Tas2r121	A	G	6: 132,700,848	S54P	probably damaging	Het
Tctex1d1	A	T	4: 103,002,571	T103S	possibly damaging	Het
Tmem206	T	C	1: 191,348,468	V295A	probably damaging	Het
Ttc21b	T	C	2: 66,236,283	E342G	possibly damaging	Het
Ubap2l	A	G	3: 90,012,730	Y818H	probably damaging	Het
Usp15	C	A	10: 123,168,351	R166I	probably damaging	Het
Vmn1r34	T	G	6: 66,637,139	H205P	probably damaging	Het
Vmn2r22	A	T	6: 123,650,634	M1K	probably null	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Zdhhc1	T	C	8: 105,483,770	N5S	probably benign	Het
Zfp758	T	A	17: 22,375,855	C441S	probably benign	Het
Zp2	T	C	7: 120,138,092	E291G	possibly damaging	Het

Other mutations in Patj

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Patj	APN	4	98465106	missense	probably damaging	1.00
IGL00095:Patj	APN	4	98535562	missense	possibly damaging	0.78
IGL00517:Patj	APN	4	98441071	missense	possibly damaging	0.95
IGL00802:Patj	APN	4	98424406	missense	possibly damaging	0.93
IGL01064:Patj	APN	4	98496973	missense	possibly damaging	0.95
IGL01110:Patj	APN	4	98413024	missense	probably damaging	0.99
IGL01407:Patj	APN	4	98413050	missense	possibly damaging	0.49
IGL01821:Patj	APN	4	98456211	missense	probably damaging	1.00
IGL02399:Patj	APN	4	98591936	missense	probably damaging	1.00
IGL02494:Patj	APN	4	98703987	splice site	probably benign
IGL02803:Patj	APN	4	98426064	missense	probably damaging	0.99
IGL02931:Patj	APN	4	98411173	splice site	probably benign
IGL03017:Patj	APN	4	98465027	splice site	probably benign
IGL03115:Patj	APN	4	98443803	missense	probably damaging	1.00
IGL03209:Patj	APN	4	98465140	missense	probably null	1.00
IGL03377:Patj	APN	4	98465104	missense	probably damaging	1.00
D4186:Patj	UTSW	4	98638762	missense	probably benign	0.17
PIT4531001:Patj	UTSW	4	98441090	missense	probably damaging	0.98
R0136:Patj	UTSW	4	98667648	missense	probably damaging	1.00
R0294:Patj	UTSW	4	98497048	missense	probably damaging	0.99
R0376:Patj	UTSW	4	98568987	missense	probably damaging	1.00
R0463:Patj	UTSW	4	98674308	missense	probably damaging	1.00
R0465:Patj	UTSW	4	98535507	splice site	probably null
R0466:Patj	UTSW	4	98688156	missense	probably damaging	1.00
R0544:Patj	UTSW	4	98569110	missense	probably damaging	1.00
R0624:Patj	UTSW	4	98681235	splice site	probably benign
R0657:Patj	UTSW	4	98667648	missense	probably damaging	1.00
R1281:Patj	UTSW	4	98416695	missense	probably damaging	1.00
R1393:Patj	UTSW	4	98424411	missense	probably benign	0.01
R1480:Patj	UTSW	4	98469582	missense	probably damaging	1.00
R1667:Patj	UTSW	4	98413027	missense	probably damaging	1.00
R1728:Patj	UTSW	4	98431780	missense	possibly damaging	0.50
R1729:Patj	UTSW	4	98431780	missense	possibly damaging	0.50
R1797:Patj	UTSW	4	98687438	missense	probably damaging	1.00
R1818:Patj	UTSW	4	98623648	missense	possibly damaging	0.85
R1835:Patj	UTSW	4	98491590	missense	probably benign	0.00
R1880:Patj	UTSW	4	98497240	missense	probably benign	0.00
R2009:Patj	UTSW	4	98456169	missense	probably damaging	1.00
R2090:Patj	UTSW	4	98437323	unclassified	probably benign
R2120:Patj	UTSW	4	98456225	missense	probably benign	0.01
R2180:Patj	UTSW	4	98523502	critical splice donor site	probably null
R2655:Patj	UTSW	4	98437450	missense	possibly damaging	0.64
R3156:Patj	UTSW	4	98674228	missense	probably damaging	1.00
R3749:Patj	UTSW	4	98469600	missense	probably damaging	1.00
R3767:Patj	UTSW	4	98681219	nonsense	probably null
R3913:Patj	UTSW	4	98569101	missense	probably damaging	0.99
R3917:Patj	UTSW	4	98592008	nonsense	probably null
R3918:Patj	UTSW	4	98456218	missense	probably damaging	1.00
R4299:Patj	UTSW	4	98677321	missense	possibly damaging	0.89
R4355:Patj	UTSW	4	98650454	missense	possibly damaging	0.87
R4471:Patj	UTSW	4	98535579	missense	probably damaging	1.00
R4762:Patj	UTSW	4	98405570	nonsense	probably null
R4877:Patj	UTSW	4	98569058	missense	possibly damaging	0.94
R4945:Patj	UTSW	4	98495064	missense	probably damaging	0.97
R5343:Patj	UTSW	4	98676193	missense	probably damaging	1.00
R5554:Patj	UTSW	4	98454396	missense	possibly damaging	0.79
R5688:Patj	UTSW	4	98520810	nonsense	probably null
R5880:Patj	UTSW	4	98411145	missense	probably damaging	0.96
R5972:Patj	UTSW	4	98569053	missense	probably damaging	0.98
R6149:Patj	UTSW	4	98424325	missense	possibly damaging	0.72
R6192:Patj	UTSW	4	98456157	missense	probably damaging	1.00
R6265:Patj	UTSW	4	98469567	missense	probably benign	0.08
R6350:Patj	UTSW	4	98405618	missense	probably benign	0.26
R6363:Patj	UTSW	4	98431860	missense	probably benign	0.25
R6434:Patj	UTSW	4	98491629	missense	probably damaging	1.00
R6496:Patj	UTSW	4	98416752	missense	probably damaging	1.00
R6896:Patj	UTSW	4	98426050	missense	possibly damaging	0.87
R7039:Patj	UTSW	4	98569078	missense	probably damaging	0.96
R7040:Patj	UTSW	4	98441080	missense	probably benign	0.02
R7052:Patj	UTSW	4	98677260	missense	probably benign	0.03
R7066:Patj	UTSW	4	98413197	missense	probably benign	0.24
R7236:Patj	UTSW	4	98411057	missense	probably damaging	1.00
R7242:Patj	UTSW	4	98591933	missense	probably benign	0.26
R7260:Patj	UTSW	4	98416733	missense	possibly damaging	0.94
R7412:Patj	UTSW	4	98411139	missense	probably damaging	0.98
R7493:Patj	UTSW	4	98495061	missense	probably benign	0.41
R7570:Patj	UTSW	4	98424500	splice site	probably null
R7571:Patj	UTSW	4	98568980	missense	probably damaging	1.00
R7626:Patj	UTSW	4	98546987	missense	probably benign	0.35
R7658:Patj	UTSW	4	98688179	missense	probably damaging	1.00
R7664:Patj	UTSW	4	98496950	missense	possibly damaging	0.92
R7669:Patj	UTSW	4	98518942	missense	probably damaging	1.00
R7796:Patj	UTSW	4	98546983	start codon destroyed	probably benign	0.05
R7870:Patj	UTSW	4	98424316	missense	probably damaging	1.00
R7883:Patj	UTSW	4	98611135	missense	probably benign	0.00
R7948:Patj	UTSW	4	98424310	missense	probably damaging	0.99
R8050:Patj	UTSW	4	98538964	missense	probably benign	0.00
R8483:Patj	UTSW	4	98424302	missense	probably damaging	1.00
R8546:Patj	UTSW	4	98437397	missense	probably benign	0.00
R8746:Patj	UTSW	4	98505830	intron	probably benign
R8844:Patj	UTSW	4	98591969	missense	probably damaging	1.00
R8905:Patj	UTSW	4	98497175	missense	probably damaging	1.00
R8912:Patj	UTSW	4	98497328	missense
R8959:Patj	UTSW	4	98591975	missense	probably damaging	0.99
R9083:Patj	UTSW	4	98513634	missense	probably benign	0.03
R9173:Patj	UTSW	4	98638721	missense	probably benign
R9206:Patj	UTSW	4	98539073	missense	unknown
R9208:Patj	UTSW	4	98539073	missense	unknown
R9347:Patj	UTSW	4	98688247	missense	probably benign	0.19
R9560:Patj	UTSW	4	98682052	missense	probably benign	0.29
R9609:Patj	UTSW	4	98688236	missense	probably benign	0.00
R9617:Patj	UTSW	4	98505754	missense	probably benign	0.03
R9658:Patj	UTSW	4	98465140	missense	probably null	1.00
R9756:Patj	UTSW	4	98677298	missense	probably benign
Z1176:Patj	UTSW	4	98611130	missense	probably benign	0.11
Z1176:Patj	UTSW	4	98676318	nonsense	probably null
Z1177:Patj	UTSW	4	98497174	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGGAAACGTTCTCTCTGCTC -3'
(R):5'- AACTCGGCACAGAGGATTAC -3'

Sequencing Primer
(F):5'- CTGCTCATTTACTGATGGGAATACTG -3'
(R):5'- TTGCTGCGATGAAATGCCATGAC -3'

Posted On

2016-07-22