Incidental Mutation 'R5274:Gm5155'
ID403818
Institutional Source Beutler Lab
Gene Symbol Gm5155
Ensembl Gene ENSMUSG00000078793
Gene Namepredicted gene 5155
Synonyms
MMRRC Submission 042837-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5274 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location17871768-17919024 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 17915717 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072381
SMART Domains Protein: ENSMUSP00000072218
Gene: ENSMUSG00000078793

DomainStartEndE-ValueType
IG 40 141 2.27e-2 SMART
IG_like 160 261 2.73e1 SMART
IG_like 277 378 6.69e0 SMART
IG_like 397 498 4.07e1 SMART
IG_like 514 615 6.52e0 SMART
IG_like 634 735 1.05e1 SMART
IG 753 853 1.28e-1 SMART
IGc2 869 933 3.82e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165490
SMART Domains Protein: ENSMUSP00000130117
Gene: ENSMUSG00000078793

DomainStartEndE-ValueType
IG 40 141 2.94e-1 SMART
IG_like 160 261 2.73e1 SMART
IG_like 277 378 6.69e0 SMART
IG_like 397 498 4.07e1 SMART
IG_like 514 615 6.52e0 SMART
IG_like 634 735 1.05e1 SMART
IG 753 853 1.28e-1 SMART
IGc2 869 933 3.82e-9 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 98.0%
  • 20x: 96.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,235,659 R155H probably benign Het
Ace T C 11: 105,968,037 M19T probably benign Het
Agl A G 3: 116,772,486 L995P probably damaging Het
AY761185 T C 8: 20,943,873 N90S unknown Het
Brca2 T C 5: 150,539,689 S973P probably benign Het
Cacna1e T C 1: 154,700,504 T66A probably damaging Het
Cbarp T C 10: 80,131,815 S531G possibly damaging Het
Cd96 G T 16: 46,069,703 T319K possibly damaging Het
Chil5 A C 3: 106,028,853 F41C probably damaging Het
Col24a1 A C 3: 145,484,678 E1239D probably benign Het
Dip2b A G 15: 100,212,104 E1490G possibly damaging Het
Dync1li1 T C 9: 114,715,205 V315A possibly damaging Het
Dync2h1 T C 9: 7,116,540 S99G probably benign Het
E2f8 C T 7: 48,867,177 R818H probably damaging Het
Eomes T C 9: 118,480,529 V250A probably damaging Het
Esyt3 T C 9: 99,318,297 T615A probably benign Het
Fbxo38 A T 18: 62,515,069 D799E probably damaging Het
Fdft1 A G 14: 63,152,343 F288S probably damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm4871 C G 5: 145,030,370 E185Q probably damaging Het
Gm5901 C A 7: 105,377,448 P141Q probably damaging Het
Herc1 T A 9: 66,399,409 I933N probably benign Het
Ifih1 T C 2: 62,611,718 Q385R probably benign Het
Ighmbp2 T C 19: 3,265,518 E634G probably damaging Het
Klk6 C G 7: 43,829,129 probably null Het
Kmt2d A G 15: 98,854,230 probably benign Het
Lig3 T A 11: 82,797,292 probably null Het
Lrp1b T C 2: 41,344,444 D310G probably null Het
Mroh6 A G 15: 75,885,000 V571A possibly damaging Het
Olfm5 A G 7: 104,159,983 S132P probably damaging Het
Olfr488 A T 7: 108,255,635 F168I probably benign Het
Olfr659 T C 7: 104,671,526 S275P probably damaging Het
Patj G C 4: 98,518,981 S4T probably damaging Het
Pcdhga12 T A 18: 37,766,422 C102* probably null Het
Pik3ap1 T C 19: 41,281,952 D766G possibly damaging Het
Plch2 A T 4: 154,998,954 L408Q probably damaging Het
Pnma2 G T 14: 66,916,760 R211L probably damaging Het
Prkg2 T A 5: 98,969,991 H468L probably damaging Het
Rad1 T A 15: 10,487,973 probably null Het
Rims3 A G 4: 120,891,374 D264G probably damaging Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rrm2 T A 12: 24,710,407 Y75* probably null Het
Sall3 T C 18: 80,969,837 N1128S probably benign Het
Slc26a5 T C 5: 21,813,901 T610A possibly damaging Het
Snx29 G T 16: 11,738,404 E766D probably damaging Het
Sox17 A G 1: 4,491,888 V298A possibly damaging Het
Spert A G 14: 75,583,226 V362A probably benign Het
Ss18 G A 18: 14,641,049 Q228* probably null Het
Tas2r121 A G 6: 132,700,848 S54P probably damaging Het
Tctex1d1 A T 4: 103,002,571 T103S possibly damaging Het
Tmem206 T C 1: 191,348,468 V295A probably damaging Het
Ttc21b T C 2: 66,236,283 E342G possibly damaging Het
Ubap2l A G 3: 90,012,730 Y818H probably damaging Het
Usp15 C A 10: 123,168,351 R166I probably damaging Het
Vmn1r34 T G 6: 66,637,139 H205P probably damaging Het
Vmn2r22 A T 6: 123,650,634 M1K probably null Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zdhhc1 T C 8: 105,483,770 N5S probably benign Het
Zfp758 T A 17: 22,375,855 C441S probably benign Het
Zp2 T C 7: 120,138,092 E291G possibly damaging Het
Other mutations in Gm5155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Gm5155 APN 7 17910697 missense probably benign 0.32
IGL01085:Gm5155 APN 7 17915691 missense possibly damaging 0.71
IGL01135:Gm5155 APN 7 17902471 exon noncoding transcript
IGL01291:Gm5155 APN 7 17905116 exon noncoding transcript
IGL02252:Gm5155 APN 7 17910532 missense possibly damaging 0.93
IGL03243:Gm5155 APN 7 17918649 exon noncoding transcript
R0113:Gm5155 UTSW 7 17908948 exon noncoding transcript
R0833:Gm5155 UTSW 7 17904981 missense possibly damaging 0.95
R0836:Gm5155 UTSW 7 17904981 missense possibly damaging 0.95
R1462:Gm5155 UTSW 7 17915591 exon noncoding transcript
R1473:Gm5155 UTSW 7 17905091 exon noncoding transcript
R1817:Gm5155 UTSW 7 17873330 exon noncoding transcript
R1905:Gm5155 UTSW 7 17873552 exon noncoding transcript
R2362:Gm5155 UTSW 7 17902473 exon noncoding transcript
R3721:Gm5155 UTSW 7 17902738 missense probably benign 0.41
R4305:Gm5155 UTSW 7 17905193 missense probably benign 0.19
R4567:Gm5155 UTSW 7 17908966 missense probably damaging 0.97
R4587:Gm5155 UTSW 7 17886224 missense possibly damaging 0.47
R4691:Gm5155 UTSW 7 17908966 missense possibly damaging 0.93
R4989:Gm5155 UTSW 7 17905218 splice site probably null
R5023:Gm5155 UTSW 7 17902706 missense probably damaging 1.00
R5024:Gm5155 UTSW 7 17910682 missense probably benign 0.06
R5279:Gm5155 UTSW 7 17873289 splice site noncoding transcript
R5304:Gm5155 UTSW 7 17902692 missense probably benign 0.06
R5312:Gm5155 UTSW 7 17909142 missense probably damaging 1.00
R5899:Gm5155 UTSW 7 17917444 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAGTTCAAGCTTGCCAGGG -3'
(R):5'- CTCTGACAACTAAAGCTGAGTTG -3'

Sequencing Primer
(F):5'- AGGGCCTGCACACAGTG -3'
(R):5'- AGCTGAGTTGCTTTCCTTCAATGAC -3'
Posted On2016-07-22