Incidental Mutation 'R5274:Rrm2'
ID403839
Institutional Source Beutler Lab
Gene Symbol Rrm2
Ensembl Gene ENSMUSG00000020649
Gene Nameribonucleotide reductase M2
SynonymsR2
MMRRC Submission 042837-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5274 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location24708241-24714146 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 24710407 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 75 (Y75*)
Ref Sequence ENSEMBL: ENSMUSP00000119502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020980] [ENSMUST00000153058] [ENSMUST00000154588]
Predicted Effect probably null
Transcript: ENSMUST00000020980
AA Change: Y163*
SMART Domains Protein: ENSMUSP00000020980
Gene: ENSMUSG00000020649
AA Change: Y163*

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 80 347 1.6e-124 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147789
Predicted Effect probably null
Transcript: ENSMUST00000153058
AA Change: Y132*
SMART Domains Protein: ENSMUSP00000120893
Gene: ENSMUSG00000020649
AA Change: Y132*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Ribonuc_red_sm 40 225 2.6e-85 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154588
AA Change: Y75*
SMART Domains Protein: ENSMUSP00000119502
Gene: ENSMUSG00000020649
AA Change: Y75*

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 1 181 2.7e-88 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 98.0%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two non-identical subunits for ribonucleotide reductase. This reductase catalyzes the formation of deoxyribonucleotides from ribonucleotides. Synthesis of the encoded protein (M2) is regulated in a cell-cycle dependent fashion. Transcription from this gene can initiate from alternative promoters, which results in two isoforms that differ in the lengths of their N-termini. Related pseudogenes have been identified on chromosomes 1 and X. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,235,659 R155H probably benign Het
Ace T C 11: 105,968,037 M19T probably benign Het
Agl A G 3: 116,772,486 L995P probably damaging Het
AY761185 T C 8: 20,943,873 N90S unknown Het
Brca2 T C 5: 150,539,689 S973P probably benign Het
Cacna1e T C 1: 154,700,504 T66A probably damaging Het
Cbarp T C 10: 80,131,815 S531G possibly damaging Het
Cd96 G T 16: 46,069,703 T319K possibly damaging Het
Chil5 A C 3: 106,028,853 F41C probably damaging Het
Col24a1 A C 3: 145,484,678 E1239D probably benign Het
Dip2b A G 15: 100,212,104 E1490G possibly damaging Het
Dync1li1 T C 9: 114,715,205 V315A possibly damaging Het
Dync2h1 T C 9: 7,116,540 S99G probably benign Het
E2f8 C T 7: 48,867,177 R818H probably damaging Het
Eomes T C 9: 118,480,529 V250A probably damaging Het
Esyt3 T C 9: 99,318,297 T615A probably benign Het
Fbxo38 A T 18: 62,515,069 D799E probably damaging Het
Fdft1 A G 14: 63,152,343 F288S probably damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm4871 C G 5: 145,030,370 E185Q probably damaging Het
Gm5155 T C 7: 17,915,717 probably null Het
Gm5901 C A 7: 105,377,448 P141Q probably damaging Het
Herc1 T A 9: 66,399,409 I933N probably benign Het
Ifih1 T C 2: 62,611,718 Q385R probably benign Het
Ighmbp2 T C 19: 3,265,518 E634G probably damaging Het
Klk6 C G 7: 43,829,129 probably null Het
Kmt2d A G 15: 98,854,230 probably benign Het
Lig3 T A 11: 82,797,292 probably null Het
Lrp1b T C 2: 41,344,444 D310G probably null Het
Mroh6 A G 15: 75,885,000 V571A possibly damaging Het
Olfm5 A G 7: 104,159,983 S132P probably damaging Het
Olfr488 A T 7: 108,255,635 F168I probably benign Het
Olfr659 T C 7: 104,671,526 S275P probably damaging Het
Patj G C 4: 98,518,981 S4T probably damaging Het
Pcdhga12 T A 18: 37,766,422 C102* probably null Het
Pik3ap1 T C 19: 41,281,952 D766G possibly damaging Het
Plch2 A T 4: 154,998,954 L408Q probably damaging Het
Pnma2 G T 14: 66,916,760 R211L probably damaging Het
Prkg2 T A 5: 98,969,991 H468L probably damaging Het
Rad1 T A 15: 10,487,973 probably null Het
Rims3 A G 4: 120,891,374 D264G probably damaging Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Sall3 T C 18: 80,969,837 N1128S probably benign Het
Slc26a5 T C 5: 21,813,901 T610A possibly damaging Het
Snx29 G T 16: 11,738,404 E766D probably damaging Het
Sox17 A G 1: 4,491,888 V298A possibly damaging Het
Spert A G 14: 75,583,226 V362A probably benign Het
Ss18 G A 18: 14,641,049 Q228* probably null Het
Tas2r121 A G 6: 132,700,848 S54P probably damaging Het
Tctex1d1 A T 4: 103,002,571 T103S possibly damaging Het
Tmem206 T C 1: 191,348,468 V295A probably damaging Het
Ttc21b T C 2: 66,236,283 E342G possibly damaging Het
Ubap2l A G 3: 90,012,730 Y818H probably damaging Het
Usp15 C A 10: 123,168,351 R166I probably damaging Het
Vmn1r34 T G 6: 66,637,139 H205P probably damaging Het
Vmn2r22 A T 6: 123,650,634 M1K probably null Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zdhhc1 T C 8: 105,483,770 N5S probably benign Het
Zfp758 T A 17: 22,375,855 C441S probably benign Het
Zp2 T C 7: 120,138,092 E291G possibly damaging Het
Other mutations in Rrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02354:Rrm2 APN 12 24711439 splice site probably benign
IGL02361:Rrm2 APN 12 24711439 splice site probably benign
IGL02957:Rrm2 APN 12 24708441 missense probably damaging 0.99
R1804:Rrm2 UTSW 12 24708612 missense probably benign 0.42
R1854:Rrm2 UTSW 12 24713152 missense probably damaging 1.00
R3826:Rrm2 UTSW 12 24708599 missense probably benign
R3827:Rrm2 UTSW 12 24708599 missense probably benign
R3828:Rrm2 UTSW 12 24708599 missense probably benign
R3830:Rrm2 UTSW 12 24708599 missense probably benign
R3851:Rrm2 UTSW 12 24708599 missense probably benign
R3938:Rrm2 UTSW 12 24709432 missense probably damaging 1.00
R4042:Rrm2 UTSW 12 24711451 missense probably benign 0.00
R4192:Rrm2 UTSW 12 24708378 missense probably benign 0.04
R8375:Rrm2 UTSW 12 24712752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGCTTGCAAATCATGAAGAAC -3'
(R):5'- TGACAGTCCGCTTGTCATTC -3'

Sequencing Primer
(F):5'- CCTGGCTGGCCTAGAATAGAATTC -3'
(R):5'- AGTCCGCTTGTCATTCTGCTC -3'
Posted On2016-07-22