Incidental Mutation 'R5274:Sall3'
ID403855
Institutional Source Beutler Lab
Gene Symbol Sall3
Ensembl Gene ENSMUSG00000024565
Gene Namespalt like transcription factor 3
SynonymsMsal, Spalt, Msal-1, Salt, B130022O04Rik
MMRRC Submission 042837-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5274 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location80966376-80986578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80969837 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1128 (N1128S)
Ref Sequence ENSEMBL: ENSMUSP00000056967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057950]
Predicted Effect probably benign
Transcript: ENSMUST00000057950
AA Change: N1128S

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000056967
Gene: ENSMUSG00000024565
AA Change: N1128S

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 143 161 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 210 231 N/A INTRINSIC
low complexity region 271 289 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 350 371 N/A INTRINSIC
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 3.21e-4 SMART
low complexity region 555 568 N/A INTRINSIC
ZnF_C2H2 692 714 3.99e0 SMART
ZnF_C2H2 720 742 2.99e-4 SMART
ZnF_C2H2 752 774 1.6e-4 SMART
low complexity region 834 852 N/A INTRINSIC
low complexity region 901 923 N/A INTRINSIC
low complexity region 993 1007 N/A INTRINSIC
ZnF_C2H2 1061 1083 1.69e-3 SMART
ZnF_C2H2 1089 1111 5.99e-4 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 98.0%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sal-like C2H2-type zinc-finger protein, and belongs to a family of evolutionarily conserved genes found in species as diverse as Drosophila, C. elegans, and vertebrates. Mutations in some of these genes are associated with congenital disorders in human, suggesting their importance in embryonic development. This protein binds to DNA methyltransferase 3 alpha (DNMT3A), and reduces DNMT3A-mediated CpG island methylation. It is suggested that silencing of this gene, resulting in acceleration of DNA methylation, may have a role in oncogenesis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality with an impaired suckling ability, truncated soft palate, small epiglottis, and abnormal cranial nerve morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,235,659 R155H probably benign Het
Ace T C 11: 105,968,037 M19T probably benign Het
Agl A G 3: 116,772,486 L995P probably damaging Het
AY761185 T C 8: 20,943,873 N90S unknown Het
Brca2 T C 5: 150,539,689 S973P probably benign Het
Cacna1e T C 1: 154,700,504 T66A probably damaging Het
Cbarp T C 10: 80,131,815 S531G possibly damaging Het
Cd96 G T 16: 46,069,703 T319K possibly damaging Het
Chil5 A C 3: 106,028,853 F41C probably damaging Het
Col24a1 A C 3: 145,484,678 E1239D probably benign Het
Dip2b A G 15: 100,212,104 E1490G possibly damaging Het
Dync1li1 T C 9: 114,715,205 V315A possibly damaging Het
Dync2h1 T C 9: 7,116,540 S99G probably benign Het
E2f8 C T 7: 48,867,177 R818H probably damaging Het
Eomes T C 9: 118,480,529 V250A probably damaging Het
Esyt3 T C 9: 99,318,297 T615A probably benign Het
Fbxo38 A T 18: 62,515,069 D799E probably damaging Het
Fdft1 A G 14: 63,152,343 F288S probably damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm4871 C G 5: 145,030,370 E185Q probably damaging Het
Gm5155 T C 7: 17,915,717 probably null Het
Gm5901 C A 7: 105,377,448 P141Q probably damaging Het
Herc1 T A 9: 66,399,409 I933N probably benign Het
Ifih1 T C 2: 62,611,718 Q385R probably benign Het
Ighmbp2 T C 19: 3,265,518 E634G probably damaging Het
Klk6 C G 7: 43,829,129 probably null Het
Kmt2d A G 15: 98,854,230 probably benign Het
Lig3 T A 11: 82,797,292 probably null Het
Lrp1b T C 2: 41,344,444 D310G probably null Het
Mroh6 A G 15: 75,885,000 V571A possibly damaging Het
Olfm5 A G 7: 104,159,983 S132P probably damaging Het
Olfr488 A T 7: 108,255,635 F168I probably benign Het
Olfr659 T C 7: 104,671,526 S275P probably damaging Het
Patj G C 4: 98,518,981 S4T probably damaging Het
Pcdhga12 T A 18: 37,766,422 C102* probably null Het
Pik3ap1 T C 19: 41,281,952 D766G possibly damaging Het
Plch2 A T 4: 154,998,954 L408Q probably damaging Het
Pnma2 G T 14: 66,916,760 R211L probably damaging Het
Prkg2 T A 5: 98,969,991 H468L probably damaging Het
Rad1 T A 15: 10,487,973 probably null Het
Rims3 A G 4: 120,891,374 D264G probably damaging Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rrm2 T A 12: 24,710,407 Y75* probably null Het
Slc26a5 T C 5: 21,813,901 T610A possibly damaging Het
Snx29 G T 16: 11,738,404 E766D probably damaging Het
Sox17 A G 1: 4,491,888 V298A possibly damaging Het
Spert A G 14: 75,583,226 V362A probably benign Het
Ss18 G A 18: 14,641,049 Q228* probably null Het
Tas2r121 A G 6: 132,700,848 S54P probably damaging Het
Tctex1d1 A T 4: 103,002,571 T103S possibly damaging Het
Tmem206 T C 1: 191,348,468 V295A probably damaging Het
Ttc21b T C 2: 66,236,283 E342G possibly damaging Het
Ubap2l A G 3: 90,012,730 Y818H probably damaging Het
Usp15 C A 10: 123,168,351 R166I probably damaging Het
Vmn1r34 T G 6: 66,637,139 H205P probably damaging Het
Vmn2r22 A T 6: 123,650,634 M1K probably null Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zdhhc1 T C 8: 105,483,770 N5S probably benign Het
Zfp758 T A 17: 22,375,855 C441S probably benign Het
Zp2 T C 7: 120,138,092 E291G possibly damaging Het
Other mutations in Sall3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Sall3 APN 18 80973232 missense probably damaging 0.98
IGL01630:Sall3 APN 18 80971269 missense probably benign 0.03
IGL01713:Sall3 APN 18 80969847 missense probably damaging 1.00
IGL01803:Sall3 APN 18 80969832 missense possibly damaging 0.65
IGL02627:Sall3 APN 18 80972361 missense possibly damaging 0.86
IGL02858:Sall3 APN 18 80969513 missense probably damaging 1.00
IGL03177:Sall3 APN 18 80972968 missense probably benign 0.00
fountain UTSW 18 80974476 missense probably damaging 0.99
IGL02984:Sall3 UTSW 18 80973450 missense probably benign 0.01
R1055:Sall3 UTSW 18 80969792 missense probably benign 0.24
R1258:Sall3 UTSW 18 80974065 missense probably damaging 1.00
R1932:Sall3 UTSW 18 80969753 missense probably benign 0.44
R1976:Sall3 UTSW 18 80971893 missense probably benign 0.42
R2124:Sall3 UTSW 18 80971797 missense probably benign 0.01
R2142:Sall3 UTSW 18 80969831 missense probably damaging 0.98
R2199:Sall3 UTSW 18 80971870 missense probably benign 0.27
R2365:Sall3 UTSW 18 80971792 missense probably benign 0.01
R3856:Sall3 UTSW 18 80972502 missense probably damaging 1.00
R4022:Sall3 UTSW 18 80969840 missense probably benign 0.05
R4050:Sall3 UTSW 18 80971482 missense probably benign 0.03
R4085:Sall3 UTSW 18 80972133 missense probably damaging 0.99
R4764:Sall3 UTSW 18 80974476 missense probably damaging 0.99
R4874:Sall3 UTSW 18 80973973 missense probably benign 0.33
R4948:Sall3 UTSW 18 80971411 missense probably benign 0.20
R5602:Sall3 UTSW 18 80972812 missense probably benign
R6063:Sall3 UTSW 18 80974255 missense possibly damaging 0.52
R6256:Sall3 UTSW 18 80969861 missense possibly damaging 0.74
R6431:Sall3 UTSW 18 80973187 missense possibly damaging 0.94
R6523:Sall3 UTSW 18 80973188 missense possibly damaging 0.68
R6719:Sall3 UTSW 18 80971506 missense probably damaging 0.99
R6861:Sall3 UTSW 18 80974375 nonsense probably null
R7078:Sall3 UTSW 18 80974099 missense probably damaging 0.97
R7107:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7108:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7453:Sall3 UTSW 18 80972040 missense probably benign 0.07
R7491:Sall3 UTSW 18 80972705 missense probably benign 0.03
R7496:Sall3 UTSW 18 80973364 missense probably benign 0.07
R7584:Sall3 UTSW 18 80974530 missense probably benign 0.00
R7599:Sall3 UTSW 18 80972052 missense possibly damaging 0.56
R7809:Sall3 UTSW 18 80974360 missense probably benign 0.00
R8244:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8245:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8250:Sall3 UTSW 18 80973528 missense probably benign 0.01
R8335:Sall3 UTSW 18 80969586 missense probably benign 0.35
R8360:Sall3 UTSW 18 80974017 missense probably benign 0.31
R8410:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8476:Sall3 UTSW 18 80972118 nonsense probably null
R8712:Sall3 UTSW 18 80974021 missense probably benign 0.03
R8726:Sall3 UTSW 18 80986493 missense possibly damaging 0.89
Z1176:Sall3 UTSW 18 80972760 missense probably benign 0.19
Z1177:Sall3 UTSW 18 80974276 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTAGACTTACTGGGAGCTGAGG -3'
(R):5'- TCTAATAGAAGGTGCTCGGGG -3'

Sequencing Primer
(F):5'- TGAGGGATGCCTCCGTTC -3'
(R):5'- TCTGCTGACCCCAGACTAATACTTAG -3'
Posted On2016-07-22