Incidental Mutation 'R0417:Map3k6'
ID40386
Institutional Source Beutler Lab
Gene Symbol Map3k6
Ensembl Gene ENSMUSG00000028862
Gene Namemitogen-activated protein kinase kinase kinase 6
SynonymsAsk2, MAPKKK6, MEKK6
MMRRC Submission 038619-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.356) question?
Stock #R0417 (G1)
Quality Score127
Status Not validated
Chromosome4
Chromosomal Location133240818-133252929 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 133248082 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 709 (Y709*)
Ref Sequence ENSEMBL: ENSMUSP00000030677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030677]
Predicted Effect probably null
Transcript: ENSMUST00000030677
AA Change: Y709*
SMART Domains Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862
AA Change: Y709*

DomainStartEndE-ValueType
low complexity region 98 109 N/A INTRINSIC
Pfam:DUF4071 130 508 2.3e-150 PFAM
S_TKc 649 907 3.49e-87 SMART
low complexity region 925 940 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
low complexity region 975 990 N/A INTRINSIC
low complexity region 1130 1146 N/A INTRINSIC
coiled coil region 1164 1195 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134895
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that forms a component of protein kinase-mediated signal transduction cascades. The encoded kinase participates in the regulation of vascular endothelial growth factor (VEGF) expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous and heterozygous null mice display an increased incidence of chemically induced skin tumors and homozygous mice also show resistance to induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik A G 7: 4,151,483 L102P probably damaging Het
1700030K09Rik A G 8: 72,445,400 K217R probably damaging Het
1810024B03Rik A G 2: 127,186,944 Y112H probably damaging Het
A430078G23Rik T C 8: 3,388,957 probably benign Het
Acot2 T C 12: 83,990,613 Y234H probably benign Het
Alox12e C T 11: 70,321,865 V53I probably benign Het
Ankrd50 T C 3: 38,456,361 H619R probably damaging Het
Arfgef3 A T 10: 18,603,511 L1452Q probably damaging Het
Arhgap42 T C 9: 9,180,033 S82G possibly damaging Het
Bicra C A 7: 15,972,322 R1398L probably damaging Het
Boc T C 16: 44,520,234 T118A probably benign Het
Btnl9 A G 11: 49,175,595 Y381H probably damaging Het
Cbln3 T G 14: 55,884,129 E20A probably benign Het
Csrnp3 A G 2: 66,019,543 Y171C probably benign Het
Cyp2d9 A T 15: 82,455,951 I181F probably damaging Het
Cyp7b1 T A 3: 18,096,691 T295S probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dok1 A T 6: 83,031,569 D377E probably damaging Het
Eed A T 7: 89,971,552 Y87* probably null Het
Entpd3 T C 9: 120,557,421 V156A probably damaging Het
Exo5 T A 4: 120,922,072 T199S probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Ezh2 A G 6: 47,551,726 C291R probably benign Het
Flvcr1 A T 1: 191,011,219 M466K probably benign Het
Fras1 G T 5: 96,691,372 M1583I probably benign Het
Fzd9 G T 5: 135,249,619 R471S probably damaging Het
Galr1 A T 18: 82,405,540 F204Y probably damaging Het
Gm38394 A T 1: 133,658,538 S354T probably benign Het
Gna11 A T 10: 81,530,904 I324N probably damaging Het
Gucy1a2 A G 9: 3,759,484 E430G possibly damaging Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Ikzf1 A C 11: 11,769,352 N353T probably benign Het
Il7 T A 3: 7,576,027 T110S probably damaging Het
Keg1 A G 19: 12,711,060 N53D probably damaging Het
Klhl21 T C 4: 152,015,507 I558T probably damaging Het
Lca5l G A 16: 96,162,653 T357M probably damaging Het
Lrba T C 3: 86,715,654 S2448P probably damaging Het
Megf6 A G 4: 154,267,967 E1261G probably benign Het
Mettl3 C T 14: 52,296,698 G473D probably damaging Het
Mga A G 2: 119,902,790 I40V probably damaging Het
Mmp13 T A 9: 7,276,602 D232E probably benign Het
Nampt T C 12: 32,833,101 V95A probably benign Het
Nbeal1 T C 1: 60,247,734 V905A probably benign Het
Nomo1 A T 7: 46,068,698 E840V possibly damaging Het
Nprl2 A T 9: 107,543,298 I101F probably damaging Het
Nup160 A T 2: 90,735,427 I1378F possibly damaging Het
Ogdhl T C 14: 32,326,979 S69P probably damaging Het
Olfr1105 A T 2: 87,033,445 Y259N probably damaging Het
Olfr1240 C A 2: 89,440,175 V35L possibly damaging Het
Olfr1283 A G 2: 111,369,105 S158G possibly damaging Het
Olfr1390 T A 11: 49,340,673 I47N possibly damaging Het
Olfr143 T C 9: 38,253,864 F149S probably benign Het
Olfr870 G A 9: 20,171,214 A119V probably damaging Het
Olfr894 A G 9: 38,219,455 I211V probably benign Het
Osbpl3 C T 6: 50,348,018 V167I probably benign Het
Pclo T A 5: 14,713,022 H3836Q unknown Het
Prkcg A T 7: 3,304,304 probably null Het
Ror1 A T 4: 100,412,000 H345L possibly damaging Het
Slc36a2 C T 11: 55,181,544 probably null Het
Slc40a1 G A 1: 45,911,374 P306L possibly damaging Het
Slc9a8 C A 2: 167,457,344 T239K probably benign Het
Snapc3 A G 4: 83,450,162 I299V probably benign Het
Sp3 G A 2: 72,971,501 A56V possibly damaging Het
Spag17 T A 3: 100,065,554 S1361T probably benign Het
Sptbn2 A G 19: 4,737,926 T978A probably benign Het
Stom C A 2: 35,321,632 V126F probably damaging Het
Stpg2 A G 3: 139,218,321 T162A probably damaging Het
Stxbp6 G A 12: 44,902,957 T63M probably damaging Het
Tatdn1 A C 15: 58,921,350 I69S probably benign Het
Tbata A T 10: 61,180,339 D198V probably damaging Het
Tbc1d5 T C 17: 50,756,705 I638V probably benign Het
Tomm70a A G 16: 57,149,903 D548G probably benign Het
Ust A G 10: 8,245,936 F303L probably damaging Het
Vps13d A G 4: 144,976,560 S4306P probably benign Het
Zfp691 A G 4: 119,170,496 S180P possibly damaging Het
Other mutations in Map3k6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Map3k6 APN 4 133243044 splice site probably benign
IGL01060:Map3k6 APN 4 133247302 splice site probably null
IGL01116:Map3k6 APN 4 133247128 missense probably damaging 0.98
IGL01341:Map3k6 APN 4 133248060 missense possibly damaging 0.67
IGL02383:Map3k6 APN 4 133246621 splice site probably null
IGL03090:Map3k6 APN 4 133243366 missense probably benign 0.05
IGL03096:Map3k6 APN 4 133251345 nonsense probably null
IGL03149:Map3k6 APN 4 133249688 missense probably damaging 1.00
R0110:Map3k6 UTSW 4 133243794 missense probably damaging 1.00
R0142:Map3k6 UTSW 4 133250946 missense probably benign
R0189:Map3k6 UTSW 4 133246941 missense possibly damaging 0.46
R0368:Map3k6 UTSW 4 133252659 missense probably benign 0.23
R0595:Map3k6 UTSW 4 133241263 missense probably damaging 0.98
R0597:Map3k6 UTSW 4 133245552 missense possibly damaging 0.46
R0699:Map3k6 UTSW 4 133248126 missense probably damaging 1.00
R1099:Map3k6 UTSW 4 133247128 missense probably damaging 1.00
R1113:Map3k6 UTSW 4 133245815 missense probably damaging 1.00
R1308:Map3k6 UTSW 4 133245815 missense probably damaging 1.00
R1607:Map3k6 UTSW 4 133252473 missense probably damaging 1.00
R2217:Map3k6 UTSW 4 133246672 missense possibly damaging 0.46
R3734:Map3k6 UTSW 4 133248396 missense possibly damaging 0.79
R3735:Map3k6 UTSW 4 133246372 missense probably benign 0.21
R3743:Map3k6 UTSW 4 133245073 missense probably benign 0.26
R4244:Map3k6 UTSW 4 133251947 missense possibly damaging 0.65
R4245:Map3k6 UTSW 4 133251947 missense possibly damaging 0.65
R4465:Map3k6 UTSW 4 133246333 missense possibly damaging 0.66
R4482:Map3k6 UTSW 4 133243399 missense probably benign 0.00
R4827:Map3k6 UTSW 4 133248849 missense possibly damaging 0.92
R5092:Map3k6 UTSW 4 133251743 missense probably benign 0.00
R5110:Map3k6 UTSW 4 133247548 intron probably benign
R5258:Map3k6 UTSW 4 133247642 missense possibly damaging 0.81
R5369:Map3k6 UTSW 4 133247681 missense probably damaging 0.99
R5642:Map3k6 UTSW 4 133245544 missense probably damaging 0.99
R5648:Map3k6 UTSW 4 133243335 missense probably benign 0.25
R6102:Map3k6 UTSW 4 133247131 critical splice donor site probably null
R6144:Map3k6 UTSW 4 133245675 missense probably damaging 1.00
R6476:Map3k6 UTSW 4 133250086 missense probably damaging 0.98
R6511:Map3k6 UTSW 4 133248078 missense probably damaging 0.98
R6522:Map3k6 UTSW 4 133250024 missense possibly damaging 0.65
R6706:Map3k6 UTSW 4 133250939 nonsense probably null
R6874:Map3k6 UTSW 4 133250656 missense probably benign 0.02
R7069:Map3k6 UTSW 4 133251712 missense probably benign 0.01
R7216:Map3k6 UTSW 4 133246900 missense probably damaging 0.99
R7417:Map3k6 UTSW 4 133248396 missense probably benign 0.43
R7538:Map3k6 UTSW 4 133251927 missense probably benign
R7569:Map3k6 UTSW 4 133250077 missense probably benign 0.04
R8003:Map3k6 UTSW 4 133248882 missense probably benign 0.05
Z1088:Map3k6 UTSW 4 133245066 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCGCCATCAAGGAGATCCCAGAG -3'
(R):5'- ACGCACGCTAGAGTTCATTTCCC -3'

Sequencing Primer
(F):5'- tgtgtgtgtgtgtgtCTATCTG -3'
(R):5'- GCTAGAGTTCATTTCCCCTCAGG -3'
Posted On2013-05-23