Incidental Mutation 'R5275:Olfr1309'
ID403864
Institutional Source Beutler Lab
Gene Symbol Olfr1309
Ensembl Gene ENSMUSG00000109528
Gene Nameolfactory receptor 1309
SynonymsMOR245-5, GA_x6K02T2Q125-73031456-73030518
MMRRC Submission 042838-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R5275 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111979857-111990281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111983829 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 82 (I82F)
Ref Sequence ENSEMBL: ENSMUSP00000150871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099604] [ENSMUST00000207885] [ENSMUST00000214537] [ENSMUST00000214935] [ENSMUST00000215045] [ENSMUST00000216948] [ENSMUST00000217452]
Predicted Effect probably damaging
Transcript: ENSMUST00000099604
AA Change: I90F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097199
Gene: ENSMUSG00000094747
AA Change: I90F

DomainStartEndE-ValueType
Pfam:7tm_4 38 311 1.5e-36 PFAM
Pfam:7tm_1 49 295 6.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207885
AA Change: I90F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214537
AA Change: I82F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214935
AA Change: I82F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215045
AA Change: I82F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216948
AA Change: I82F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217452
AA Change: I82F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.2764 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,235,659 R155H probably benign Het
Abcc1 C T 16: 14,466,186 L1222F probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Apold1 G T 6: 134,983,800 L72F probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Chd6 A G 2: 160,969,363 L1440P probably benign Het
Clca3a2 A G 3: 144,813,579 S279P probably damaging Het
Cma1 A T 14: 55,941,700 I233N probably damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Dst T C 1: 34,180,148 S1890P probably benign Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm38100 A G 1: 175,920,770 H134R probably benign Het
Gm5117 T A 8: 31,739,567 noncoding transcript Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Gm8909 T C 17: 36,161,675 probably null Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Olfr1344 A T 7: 6,440,016 T39S probably benign Het
Olfr728 T A 14: 50,140,496 I48F probably benign Het
Opa1 C T 16: 29,611,579 T451I probably damaging Het
Pcdh12 T A 18: 38,284,101 probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Ppan T A 9: 20,889,773 Y115* probably null Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Ptpn20 A G 14: 33,631,192 H296R probably benign Het
Rergl A G 6: 139,501,821 probably null Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Scfd1 A T 12: 51,415,589 H409L probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Slc24a5 C T 2: 125,085,861 T360I probably benign Het
Snx6 T C 12: 54,784,022 H51R probably damaging Het
Sorl1 A T 9: 42,030,902 V1009D probably benign Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Tlk1 C T 2: 70,752,205 probably benign Het
Tnc G A 4: 63,964,730 Q1885* probably null Het
Vcl T C 14: 21,010,078 V595A probably damaging Het
Vmn1r84 A T 7: 12,361,814 N305K probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Other mutations in Olfr1309
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Olfr1309 APN 2 111983933 missense probably damaging 1.00
IGL02479:Olfr1309 APN 2 111983385 missense probably benign 0.35
R0234:Olfr1309 UTSW 2 111983300 missense probably damaging 0.99
R0234:Olfr1309 UTSW 2 111983300 missense probably damaging 0.99
R1777:Olfr1309 UTSW 2 111983697 missense possibly damaging 0.64
R1994:Olfr1309 UTSW 2 111984084 missense probably benign
R3892:Olfr1309 UTSW 2 111983141 missense probably benign 0.03
R3946:Olfr1309 UTSW 2 111983297 missense possibly damaging 0.68
R4541:Olfr1309 UTSW 2 111983636 missense probably benign 0.01
R5150:Olfr1309 UTSW 2 111984021 missense probably benign 0.11
R5293:Olfr1309 UTSW 2 111983266 missense probably damaging 0.99
R6080:Olfr1309 UTSW 2 111983705 missense probably damaging 1.00
R6258:Olfr1309 UTSW 2 111984051 missense probably benign 0.05
R6260:Olfr1309 UTSW 2 111984051 missense probably benign 0.05
R6291:Olfr1309 UTSW 2 111983624 missense probably benign 0.00
R6442:Olfr1309 UTSW 2 111983529 missense probably damaging 0.99
R7013:Olfr1309 UTSW 2 111983963 missense probably benign 0.31
R7326:Olfr1309 UTSW 2 111983327 nonsense probably null
R7483:Olfr1309 UTSW 2 111983779 missense probably damaging 0.98
X0062:Olfr1309 UTSW 2 111983601 missense probably benign 0.00
Z1176:Olfr1309 UTSW 2 111983753 missense not run
Predicted Primers PCR Primer
(F):5'- TCGTGGGCTCATGATGATCAG -3'
(R):5'- TGTATGGAATGAACTGCTCTGTAG -3'

Sequencing Primer
(F):5'- GCTCATGATGATCAGGTAATGC -3'
(R):5'- CCTCGGGATCACTAATATATGGG -3'
Posted On2016-07-22