Incidental Mutation 'R5275:Slc24a5'
ID403865
Institutional Source Beutler Lab
Gene Symbol Slc24a5
Ensembl Gene ENSMUSG00000035183
Gene Namesolute carrier family 24, member 5
SynonymsOca6, NCX5, F630045L20Rik, NCKX5
MMRRC Submission 042838-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5275 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location125068124-125088677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125085861 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 360 (T360I)
Ref Sequence ENSEMBL: ENSMUSP00000063887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067780] [ENSMUST00000070353] [ENSMUST00000110501] [ENSMUST00000142718] [ENSMUST00000147105] [ENSMUST00000152367]
Predicted Effect probably benign
Transcript: ENSMUST00000067780
SMART Domains Protein: ENSMUSP00000066312
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 430 450 N/A INTRINSIC
RRM 498 569 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070353
AA Change: T360I

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000063887
Gene: ENSMUSG00000035183
AA Change: T360I

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Na_Ca_ex 72 216 1.1e-24 PFAM
low complexity region 274 290 N/A INTRINSIC
low complexity region 311 324 N/A INTRINSIC
Pfam:Na_Ca_ex 334 485 7.6e-31 PFAM
low complexity region 488 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089825
SMART Domains Protein: ENSMUSP00000087258
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 48 121 1.84e-22 SMART
low complexity region 154 167 N/A INTRINSIC
RRM 181 253 5.12e-21 SMART
low complexity region 274 291 N/A INTRINSIC
low complexity region 386 406 N/A INTRINSIC
RRM 454 525 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110501
SMART Domains Protein: ENSMUSP00000106127
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 430 450 N/A INTRINSIC
RRM 498 569 6.15e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139615
Predicted Effect probably benign
Transcript: ENSMUST00000142718
SMART Domains Protein: ENSMUSP00000115519
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 351 376 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
RRM 491 562 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147105
SMART Domains Protein: ENSMUSP00000114817
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
RRM 474 545 6.15e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149963
Predicted Effect probably benign
Transcript: ENSMUST00000152367
SMART Domains Protein: ENSMUSP00000123088
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 351 376 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
RRM 515 586 6.15e-24 SMART
Meta Mutation Damage Score 0.0840 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the potassium-dependent sodium/calcium exchanger family and encodes an intracellular membrane protein with 2 large hydrophilic loops and 2 sets of multiple transmembrane-spanning segments. Sequence variation in this gene has been associated with differences in skin pigmentation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypopigmentation and ocular albinism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,235,659 R155H probably benign Het
Abcc1 C T 16: 14,466,186 L1222F probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Apold1 G T 6: 134,983,800 L72F probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Chd6 A G 2: 160,969,363 L1440P probably benign Het
Clca3a2 A G 3: 144,813,579 S279P probably damaging Het
Cma1 A T 14: 55,941,700 I233N probably damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Dst T C 1: 34,180,148 S1890P probably benign Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm38100 A G 1: 175,920,770 H134R probably benign Het
Gm5117 T A 8: 31,739,567 noncoding transcript Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Gm8909 T C 17: 36,161,675 probably null Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Olfr1309 T A 2: 111,983,829 I82F probably damaging Het
Olfr1344 A T 7: 6,440,016 T39S probably benign Het
Olfr728 T A 14: 50,140,496 I48F probably benign Het
Opa1 C T 16: 29,611,579 T451I probably damaging Het
Pcdh12 T A 18: 38,284,101 probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Ppan T A 9: 20,889,773 Y115* probably null Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Ptpn20 A G 14: 33,631,192 H296R probably benign Het
Rergl A G 6: 139,501,821 probably null Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Scfd1 A T 12: 51,415,589 H409L probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Snx6 T C 12: 54,784,022 H51R probably damaging Het
Sorl1 A T 9: 42,030,902 V1009D probably benign Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Tlk1 C T 2: 70,752,205 probably benign Het
Tnc G A 4: 63,964,730 Q1885* probably null Het
Vcl T C 14: 21,010,078 V595A probably damaging Het
Vmn1r84 A T 7: 12,361,814 N305K probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Other mutations in Slc24a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Slc24a5 APN 2 125080889 missense probably damaging 1.00
IGL01307:Slc24a5 APN 2 125080880 missense probably damaging 1.00
IGL01926:Slc24a5 APN 2 125068903 missense probably benign 0.01
IGL02090:Slc24a5 APN 2 125068298 missense probably benign 0.25
IGL02313:Slc24a5 APN 2 125085647 unclassified probably benign
IGL02328:Slc24a5 APN 2 125080639 missense probably damaging 1.00
IGL02743:Slc24a5 APN 2 125088234 missense probably damaging 1.00
IGL02969:Slc24a5 APN 2 125083227 missense probably damaging 1.00
IGL03212:Slc24a5 APN 2 125080830 missense probably damaging 1.00
IGL03258:Slc24a5 APN 2 125080705 critical splice donor site probably null
R0344:Slc24a5 UTSW 2 125085701 missense probably benign 0.03
R0811:Slc24a5 UTSW 2 125068804 missense probably damaging 0.98
R0812:Slc24a5 UTSW 2 125068804 missense probably damaging 0.98
R1018:Slc24a5 UTSW 2 125068907 missense probably damaging 1.00
R1574:Slc24a5 UTSW 2 125080862 missense probably damaging 0.96
R1574:Slc24a5 UTSW 2 125080862 missense probably damaging 0.96
R1753:Slc24a5 UTSW 2 125083195 missense possibly damaging 0.53
R2147:Slc24a5 UTSW 2 125087441 missense probably damaging 1.00
R4934:Slc24a5 UTSW 2 125088020 missense probably damaging 1.00
R4964:Slc24a5 UTSW 2 125068268 missense probably benign 0.20
R4966:Slc24a5 UTSW 2 125068268 missense probably benign 0.20
R5225:Slc24a5 UTSW 2 125085819 missense probably damaging 0.99
R5438:Slc24a5 UTSW 2 125068865 missense probably damaging 1.00
R5866:Slc24a5 UTSW 2 125085671 missense probably damaging 1.00
R6038:Slc24a5 UTSW 2 125085731 missense probably benign 0.04
R6038:Slc24a5 UTSW 2 125085731 missense probably benign 0.04
R6114:Slc24a5 UTSW 2 125083092 missense probably benign 0.01
R6211:Slc24a5 UTSW 2 125088251 missense probably benign 0.23
R6516:Slc24a5 UTSW 2 125088107 missense probably benign 0.01
R6675:Slc24a5 UTSW 2 125080695 missense possibly damaging 0.82
R6677:Slc24a5 UTSW 2 125080695 missense possibly damaging 0.82
R6826:Slc24a5 UTSW 2 125068858 missense probably benign 0.00
R7100:Slc24a5 UTSW 2 125080671 missense probably damaging 1.00
R7122:Slc24a5 UTSW 2 125088191 missense probably benign 0.15
R7381:Slc24a5 UTSW 2 125068949 missense probably benign 0.29
R7398:Slc24a5 UTSW 2 125085774 nonsense probably null
R7401:Slc24a5 UTSW 2 125088191 missense probably benign 0.15
X0067:Slc24a5 UTSW 2 125087503 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAAATGTTGAACTTTCCCACCACAG -3'
(R):5'- AAAACATGAATGAGCTTGCTGG -3'

Sequencing Primer
(F):5'- GTTTTCAGCATGCCAGAAGC -3'
(R):5'- AAACATGAATGAGCTTGCTGGTTTTG -3'
Posted On2016-07-22