Incidental Mutation 'R5275:Alpl'
ID403875
Institutional Source Beutler Lab
Gene Symbol Alpl
Ensembl Gene ENSMUSG00000028766
Gene Namealkaline phosphatase, liver/bone/kidney
SynonymsTNSALP, TNAP, Akp-2, Akp2
MMRRC Submission 042838-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5275 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location137741733-137796384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137749608 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 245 (T245A)
Ref Sequence ENSEMBL: ENSMUSP00000030551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030551] [ENSMUST00000139951] [ENSMUST00000153588]
Predicted Effect probably benign
Transcript: ENSMUST00000030551
AA Change: T245A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030551
Gene: ENSMUSG00000028766
AA Change: T245A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
alkPPc 52 491 4.69e-285 SMART
low complexity region 500 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139951
SMART Domains Protein: ENSMUSP00000125041
Gene: ENSMUSG00000028766

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Alk_phosphatase 51 216 5.2e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141451
Predicted Effect probably benign
Transcript: ENSMUST00000153588
SMART Domains Protein: ENSMUSP00000116308
Gene: ENSMUSG00000028766

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Alk_phosphatase 51 158 2e-44 PFAM
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes a preproprotein that is proteolytically cleaved to yield a signal peptide and a proproptein that is subsequently processed to generate the active mature peptide. The encoded protein is a membrane-bound glycosylated enzyme that catalyzes the hydrolysis of phosphate esters at alkaline pH. The mature peptide maintains the ratio of inorganic phosphate to inorganic pyrophosphate required for bone mineralization. Mice that lack this enzyme show symptoms of osteomalacia, softening of the bones. In humans, mutations in this gene are associated with hypophosphatasia, an inherited metabolic bone disease in which deficiency of this enzyme inhibits bone mineralization leading to skeletal defects. Mutations in the mouse gene mirror the symptoms of human hypophosphatasia. A pseudogene of this gene is present on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Males hemizygous for a null mutation exhibit reduced body size, shortened hindlimbs and tail, osteomalacia, and markedly reduced plasma phosphate levels due to impaired kidney reabsorption. Female heterozygotes exhibit milder symptoms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,235,659 R155H probably benign Het
Abcc1 C T 16: 14,466,186 L1222F probably damaging Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Apold1 G T 6: 134,983,800 L72F probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Chd6 A G 2: 160,969,363 L1440P probably benign Het
Clca3a2 A G 3: 144,813,579 S279P probably damaging Het
Cma1 A T 14: 55,941,700 I233N probably damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Dst T C 1: 34,180,148 S1890P probably benign Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm38100 A G 1: 175,920,770 H134R probably benign Het
Gm5117 T A 8: 31,739,567 noncoding transcript Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Gm8909 T C 17: 36,161,675 probably null Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Olfr1309 T A 2: 111,983,829 I82F probably damaging Het
Olfr1344 A T 7: 6,440,016 T39S probably benign Het
Olfr728 T A 14: 50,140,496 I48F probably benign Het
Opa1 C T 16: 29,611,579 T451I probably damaging Het
Pcdh12 T A 18: 38,284,101 probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Ppan T A 9: 20,889,773 Y115* probably null Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Ptpn20 A G 14: 33,631,192 H296R probably benign Het
Rergl A G 6: 139,501,821 probably null Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Scfd1 A T 12: 51,415,589 H409L probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Slc24a5 C T 2: 125,085,861 T360I probably benign Het
Snx6 T C 12: 54,784,022 H51R probably damaging Het
Sorl1 A T 9: 42,030,902 V1009D probably benign Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Tlk1 C T 2: 70,752,205 probably benign Het
Tnc G A 4: 63,964,730 Q1885* probably null Het
Vcl T C 14: 21,010,078 V595A probably damaging Het
Vmn1r84 A T 7: 12,361,814 N305K probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Other mutations in Alpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Alpl APN 4 137743313 splice site probably benign
IGL02164:Alpl APN 4 137753979 missense probably damaging 1.00
IGL02379:Alpl APN 4 137742558 missense probably damaging 1.00
IGL02632:Alpl APN 4 137753906 missense probably damaging 0.98
IGL02926:Alpl APN 4 137742634 missense probably damaging 1.00
R0492:Alpl UTSW 4 137749576 unclassified probably null
R1157:Alpl UTSW 4 137754020 missense probably damaging 1.00
R2013:Alpl UTSW 4 137755147 missense probably benign 0.00
R2067:Alpl UTSW 4 137749545 unclassified probably benign
R4412:Alpl UTSW 4 137758628 missense possibly damaging 0.84
R4440:Alpl UTSW 4 137747813 missense probably damaging 1.00
R5295:Alpl UTSW 4 137749608 missense probably benign 0.00
R5529:Alpl UTSW 4 137746422 missense probably damaging 0.99
R6706:Alpl UTSW 4 137746429 missense probably benign 0.00
R7291:Alpl UTSW 4 137752698 missense probably damaging 1.00
R7693:Alpl UTSW 4 137743809 missense probably damaging 1.00
R7694:Alpl UTSW 4 137743809 missense probably damaging 1.00
X0017:Alpl UTSW 4 137746467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGGTCAGTACGGTAGAGC -3'
(R):5'- AATCGTTCAGAGAGGGAGCC -3'

Sequencing Primer
(F):5'- GCAAACAGAGGAACATCTGGACTC -3'
(R):5'- TTGCCTAGCTGGACAACCGTC -3'
Posted On2016-07-22