Incidental Mutation 'R5275:Vmn1r84'
ID403884
Institutional Source Beutler Lab
Gene Symbol Vmn1r84
Ensembl Gene ENSMUSG00000066803
Gene Namevomeronasal 1 receptor 84
SynonymsV1rg11
MMRRC Submission 042838-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R5275 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location12360313-12369273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12361814 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 305 (N305K)
Ref Sequence ENSEMBL: ENSMUSP00000154484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086228] [ENSMUST00000226408] [ENSMUST00000227427] [ENSMUST00000228653]
Predicted Effect probably benign
Transcript: ENSMUST00000086228
AA Change: N317K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083405
Gene: ENSMUSG00000066803
AA Change: N317K

DomainStartEndE-ValueType
Pfam:TAS2R 16 312 3.7e-11 PFAM
Pfam:V1R 45 308 1.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177845
Predicted Effect probably benign
Transcript: ENSMUST00000226408
AA Change: N305K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226811
Predicted Effect probably benign
Transcript: ENSMUST00000227427
AA Change: N305K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228653
AA Change: N305K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228741
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,235,659 R155H probably benign Het
Abcc1 C T 16: 14,466,186 L1222F probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Apold1 G T 6: 134,983,800 L72F probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Chd6 A G 2: 160,969,363 L1440P probably benign Het
Clca3a2 A G 3: 144,813,579 S279P probably damaging Het
Cma1 A T 14: 55,941,700 I233N probably damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Dst T C 1: 34,180,148 S1890P probably benign Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm38100 A G 1: 175,920,770 H134R probably benign Het
Gm5117 T A 8: 31,739,567 noncoding transcript Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Gm8909 T C 17: 36,161,675 probably null Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Olfr1309 T A 2: 111,983,829 I82F probably damaging Het
Olfr1344 A T 7: 6,440,016 T39S probably benign Het
Olfr728 T A 14: 50,140,496 I48F probably benign Het
Opa1 C T 16: 29,611,579 T451I probably damaging Het
Pcdh12 T A 18: 38,284,101 probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Ppan T A 9: 20,889,773 Y115* probably null Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Ptpn20 A G 14: 33,631,192 H296R probably benign Het
Rergl A G 6: 139,501,821 probably null Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Scfd1 A T 12: 51,415,589 H409L probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Slc24a5 C T 2: 125,085,861 T360I probably benign Het
Snx6 T C 12: 54,784,022 H51R probably damaging Het
Sorl1 A T 9: 42,030,902 V1009D probably benign Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Tlk1 C T 2: 70,752,205 probably benign Het
Tnc G A 4: 63,964,730 Q1885* probably null Het
Vcl T C 14: 21,010,078 V595A probably damaging Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Other mutations in Vmn1r84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02505:Vmn1r84 APN 7 12362419 missense probably damaging 1.00
K3955:Vmn1r84 UTSW 7 12361957 missense probably damaging 0.98
R0360:Vmn1r84 UTSW 7 12361872 missense probably damaging 1.00
R0399:Vmn1r84 UTSW 7 12361867 missense probably benign 0.26
R0697:Vmn1r84 UTSW 7 12362763 start codon destroyed probably null 0.53
R1613:Vmn1r84 UTSW 7 12362533 missense possibly damaging 0.80
R1636:Vmn1r84 UTSW 7 12362595 missense probably benign 0.12
R1872:Vmn1r84 UTSW 7 12362628 missense probably benign 0.17
R4022:Vmn1r84 UTSW 7 12361930 missense probably benign
R4923:Vmn1r84 UTSW 7 12361816 missense probably benign
R5189:Vmn1r84 UTSW 7 12362458 missense probably benign 0.10
R5721:Vmn1r84 UTSW 7 12362226 missense probably damaging 1.00
R6151:Vmn1r84 UTSW 7 12361914 missense possibly damaging 0.72
R7261:Vmn1r84 UTSW 7 12362142 missense probably damaging 1.00
R7513:Vmn1r84 UTSW 7 12362067 missense probably benign 0.00
R7573:Vmn1r84 UTSW 7 12361860 missense probably benign 0.17
R8039:Vmn1r84 UTSW 7 12362008 missense not run
Z1177:Vmn1r84 UTSW 7 12362512 missense not run
Z1177:Vmn1r84 UTSW 7 12362659 missense not run
Predicted Primers PCR Primer
(F):5'- TCTGCAATACATGATGACCCC -3'
(R):5'- GTCTCCCCTGAAGACAAAGC -3'

Sequencing Primer
(F):5'- AGCCAGCATTATGATAGCTA -3'
(R):5'- GCCACAAAAACCATCTTGATTCTTG -3'
Posted On2016-07-22