Incidental Mutation 'R5275:Snx6'
ID403897
Institutional Source Beutler Lab
Gene Symbol Snx6
Ensembl Gene ENSMUSG00000005656
Gene Namesorting nexin 6
Synonyms2810425K19Rik, 2010006G21Rik, 2610032J07Rik
MMRRC Submission 042838-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.838) question?
Stock #R5275 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location54746349-54795703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54784022 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 51 (H51R)
Ref Sequence ENSEMBL: ENSMUSP00000005798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005798] [ENSMUST00000218934] [ENSMUST00000219781]
Predicted Effect probably damaging
Transcript: ENSMUST00000005798
AA Change: H51R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005798
Gene: ENSMUSG00000005656
AA Change: H51R

DomainStartEndE-ValueType
Pfam:PX 29 170 2.8e-21 PFAM
Pfam:Vps5 184 399 2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218066
Predicted Effect probably benign
Transcript: ENSMUST00000218934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219302
Predicted Effect possibly damaging
Transcript: ENSMUST00000219781
AA Change: H51R

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.3651 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein associates with the long isoform of the leptin receptor, the transforming growth factor-beta family of receptor serine-threonine kinases, and with receptor tyrosine kinases for platelet-derived growth factor, insulin, and epidermal growth factor. This protein may form oligomeric complexes with family member proteins through interactions of both the PX domain and the coiled coil regions of the molecules. Translocation of this protein from the cytoplasm to the nucleus occurs after binding to proviral integration site 1 protein. This gene results in two transcripts encoding two distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,235,659 R155H probably benign Het
Abcc1 C T 16: 14,466,186 L1222F probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Apold1 G T 6: 134,983,800 L72F probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Chd6 A G 2: 160,969,363 L1440P probably benign Het
Clca3a2 A G 3: 144,813,579 S279P probably damaging Het
Cma1 A T 14: 55,941,700 I233N probably damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Dst T C 1: 34,180,148 S1890P probably benign Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm38100 A G 1: 175,920,770 H134R probably benign Het
Gm5117 T A 8: 31,739,567 noncoding transcript Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Gm8909 T C 17: 36,161,675 probably null Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Olfr1309 T A 2: 111,983,829 I82F probably damaging Het
Olfr1344 A T 7: 6,440,016 T39S probably benign Het
Olfr728 T A 14: 50,140,496 I48F probably benign Het
Opa1 C T 16: 29,611,579 T451I probably damaging Het
Pcdh12 T A 18: 38,284,101 probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Ppan T A 9: 20,889,773 Y115* probably null Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Ptpn20 A G 14: 33,631,192 H296R probably benign Het
Rergl A G 6: 139,501,821 probably null Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Scfd1 A T 12: 51,415,589 H409L probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Slc24a5 C T 2: 125,085,861 T360I probably benign Het
Sorl1 A T 9: 42,030,902 V1009D probably benign Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Tlk1 C T 2: 70,752,205 probably benign Het
Tnc G A 4: 63,964,730 Q1885* probably null Het
Vcl T C 14: 21,010,078 V595A probably damaging Het
Vmn1r84 A T 7: 12,361,814 N305K probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Other mutations in Snx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Snx6 APN 12 54754309 missense probably damaging 0.99
IGL02682:Snx6 APN 12 54754345 missense probably damaging 1.00
IGL02995:Snx6 APN 12 54795510 splice site probably benign
IGL03240:Snx6 APN 12 54783443 missense probably damaging 0.98
IGL03353:Snx6 APN 12 54765684 splice site probably benign
PIT4362001:Snx6 UTSW 12 54768030 missense possibly damaging 0.80
R0458:Snx6 UTSW 12 54768136 nonsense probably null
R0610:Snx6 UTSW 12 54751789 missense probably damaging 1.00
R0689:Snx6 UTSW 12 54763656 missense probably benign 0.00
R1818:Snx6 UTSW 12 54783474 missense possibly damaging 0.95
R1819:Snx6 UTSW 12 54783474 missense possibly damaging 0.95
R4946:Snx6 UTSW 12 54770743 missense probably damaging 1.00
R5373:Snx6 UTSW 12 54770728 missense probably damaging 0.99
R5374:Snx6 UTSW 12 54770728 missense probably damaging 0.99
R5497:Snx6 UTSW 12 54757061 missense probably damaging 0.98
R5907:Snx6 UTSW 12 54754319 missense probably damaging 1.00
R5947:Snx6 UTSW 12 54770764 nonsense probably null
R6178:Snx6 UTSW 12 54760464 missense probably damaging 0.99
R6287:Snx6 UTSW 12 54747028 missense possibly damaging 0.75
R6321:Snx6 UTSW 12 54752013 missense probably damaging 1.00
R6878:Snx6 UTSW 12 54763601 intron probably null
R7055:Snx6 UTSW 12 54784079 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCAATGAACTCTGTAAAGAC -3'
(R):5'- TTGTTGGTCAAGACTACATAGCTG -3'

Sequencing Primer
(F):5'- ACAGCTACTTGGTCAGACTAGGTTC -3'
(R):5'- GGTGCACATATTTACACTCAGACG -3'
Posted On2016-07-22