Incidental Mutation 'R5275:Prl7d1'
ID 403900
Institutional Source Beutler Lab
Gene Symbol Prl7d1
Ensembl Gene ENSMUSG00000021348
Gene Name prolactin family 7, subfamily d, member 1
Synonyms Plfr, PRP, PLF-RP
MMRRC Submission 042838-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5275 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 27706337-27716736 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 27709247 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 227 (V227D)
Ref Sequence ENSEMBL: ENSMUSP00000153033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021776] [ENSMUST00000224026]
AlphaFold P04769
Predicted Effect probably damaging
Transcript: ENSMUST00000021776
AA Change: V226D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021776
Gene: ENSMUSG00000021348
AA Change: V226D

DomainStartEndE-ValueType
Pfam:Hormone_1 17 240 1.1e-78 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224026
AA Change: V227D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,235,659 R155H probably benign Het
Abcc1 C T 16: 14,466,186 L1222F probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Apold1 G T 6: 134,983,800 L72F probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Chd6 A G 2: 160,969,363 L1440P probably benign Het
Clca3a2 A G 3: 144,813,579 S279P probably damaging Het
Cma1 A T 14: 55,941,700 I233N probably damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Dst T C 1: 34,180,148 S1890P probably benign Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm38100 A G 1: 175,920,770 H134R probably benign Het
Gm5117 T A 8: 31,739,567 noncoding transcript Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Gm8909 T C 17: 36,161,675 probably null Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Olfr1309 T A 2: 111,983,829 I82F probably damaging Het
Olfr1344 A T 7: 6,440,016 T39S probably benign Het
Olfr728 T A 14: 50,140,496 I48F probably benign Het
Opa1 C T 16: 29,611,579 T451I probably damaging Het
Pcdh12 T A 18: 38,284,101 probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Ppan T A 9: 20,889,773 Y115* probably null Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Ptpn20 A G 14: 33,631,192 H296R probably benign Het
Rergl A G 6: 139,501,821 probably null Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Scfd1 A T 12: 51,415,589 H409L probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Slc24a5 C T 2: 125,085,861 T360I probably benign Het
Snx6 T C 12: 54,784,022 H51R probably damaging Het
Sorl1 A T 9: 42,030,902 V1009D probably benign Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Tlk1 C T 2: 70,752,205 probably benign Het
Tnc G A 4: 63,964,730 Q1885* probably null Het
Vcl T C 14: 21,010,078 V595A probably damaging Het
Vmn1r84 A T 7: 12,361,814 N305K probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Other mutations in Prl7d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Prl7d1 APN 13 27710166 missense possibly damaging 0.91
IGL01735:Prl7d1 APN 13 27714389 missense possibly damaging 0.83
IGL02139:Prl7d1 APN 13 27712083 missense probably damaging 1.00
PIT4305001:Prl7d1 UTSW 13 27714337 missense possibly damaging 0.90
PIT4531001:Prl7d1 UTSW 13 27710178 missense probably damaging 1.00
R0555:Prl7d1 UTSW 13 27712055 missense probably benign 0.13
R0625:Prl7d1 UTSW 13 27710140 missense probably benign 0.10
R0631:Prl7d1 UTSW 13 27710182 missense probably benign 0.32
R0837:Prl7d1 UTSW 13 27714338 missense probably benign 0.06
R1403:Prl7d1 UTSW 13 27709197 missense possibly damaging 0.89
R1403:Prl7d1 UTSW 13 27709197 missense possibly damaging 0.89
R1459:Prl7d1 UTSW 13 27709257 missense possibly damaging 0.81
R1643:Prl7d1 UTSW 13 27712131 missense possibly damaging 0.53
R1691:Prl7d1 UTSW 13 27709382 missense probably damaging 0.97
R2016:Prl7d1 UTSW 13 27710173 missense probably damaging 1.00
R3873:Prl7d1 UTSW 13 27716668 start codon destroyed probably null 0.92
R3874:Prl7d1 UTSW 13 27716668 start codon destroyed probably null 0.92
R5251:Prl7d1 UTSW 13 27709244 missense probably benign 0.33
R5295:Prl7d1 UTSW 13 27709247 missense probably damaging 0.99
R5398:Prl7d1 UTSW 13 27710074 missense probably damaging 1.00
R6798:Prl7d1 UTSW 13 27709397 critical splice acceptor site probably null
R6818:Prl7d1 UTSW 13 27714471 missense probably benign 0.07
R6825:Prl7d1 UTSW 13 27710142 missense probably benign 0.01
R7478:Prl7d1 UTSW 13 27710185 nonsense probably null
R7795:Prl7d1 UTSW 13 27709280 missense probably damaging 1.00
R7995:Prl7d1 UTSW 13 27710071 missense probably benign
R8193:Prl7d1 UTSW 13 27709247 missense
R9313:Prl7d1 UTSW 13 27709199 missense probably benign
R9424:Prl7d1 UTSW 13 27710202 missense probably benign 0.00
R9430:Prl7d1 UTSW 13 27714377 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TTGCCTGGAATGTGACTTAAGC -3'
(R):5'- CCTTTAGAAGGCATAGGTCAAAGG -3'

Sequencing Primer
(F):5'- CCTGGAATGTGACTTAAGCCACAG -3'
(R):5'- GCATAGGTCAAAGGAATACAAACAC -3'
Posted On 2016-07-22