Incidental Mutation 'R5275:Ptpn20'
ID403903
Institutional Source Beutler Lab
Gene Symbol Ptpn20
Ensembl Gene ENSMUSG00000021940
Gene Nameprotein tyrosine phosphatase, non-receptor type 20
Synonymstyp
MMRRC Submission 042838-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5275 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location33589207-33640754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33631192 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 296 (H296R)
Ref Sequence ENSEMBL: ENSMUSP00000022508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022508] [ENSMUST00000226512] [ENSMUST00000227887]
Predicted Effect probably benign
Transcript: ENSMUST00000022508
AA Change: H296R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022508
Gene: ENSMUSG00000021940
AA Change: H296R

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PTPc 164 420 1.12e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226512
Predicted Effect probably benign
Transcript: ENSMUST00000227887
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of classical tyrosine-specific protein tyrosine phosphatases. Many protein tyrosine phosphatases have been shown to regulate fundamental cellular processes. The encoded protein appears to be targeted to sites of actin polymerization. A pseudogene of this gene has been defined on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,235,659 R155H probably benign Het
Abcc1 C T 16: 14,466,186 L1222F probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Apold1 G T 6: 134,983,800 L72F probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Chd6 A G 2: 160,969,363 L1440P probably benign Het
Clca3a2 A G 3: 144,813,579 S279P probably damaging Het
Cma1 A T 14: 55,941,700 I233N probably damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Dst T C 1: 34,180,148 S1890P probably benign Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm38100 A G 1: 175,920,770 H134R probably benign Het
Gm5117 T A 8: 31,739,567 noncoding transcript Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Gm8909 T C 17: 36,161,675 probably null Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Olfr1309 T A 2: 111,983,829 I82F probably damaging Het
Olfr1344 A T 7: 6,440,016 T39S probably benign Het
Olfr728 T A 14: 50,140,496 I48F probably benign Het
Opa1 C T 16: 29,611,579 T451I probably damaging Het
Pcdh12 T A 18: 38,284,101 probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Ppan T A 9: 20,889,773 Y115* probably null Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Rergl A G 6: 139,501,821 probably null Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Scfd1 A T 12: 51,415,589 H409L probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Slc24a5 C T 2: 125,085,861 T360I probably benign Het
Snx6 T C 12: 54,784,022 H51R probably damaging Het
Sorl1 A T 9: 42,030,902 V1009D probably benign Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Tlk1 C T 2: 70,752,205 probably benign Het
Tnc G A 4: 63,964,730 Q1885* probably null Het
Vcl T C 14: 21,010,078 V595A probably damaging Het
Vmn1r84 A T 7: 12,361,814 N305K probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Other mutations in Ptpn20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Ptpn20 APN 14 33622619 missense probably benign 0.22
IGL01510:Ptpn20 APN 14 33638386 splice site probably null
R2057:Ptpn20 UTSW 14 33630985 missense probably damaging 0.98
R2262:Ptpn20 UTSW 14 33612311 missense probably benign
R3106:Ptpn20 UTSW 14 33612296 missense probably benign
R3430:Ptpn20 UTSW 14 33614528 missense possibly damaging 0.61
R4645:Ptpn20 UTSW 14 33631212 missense probably benign
R4928:Ptpn20 UTSW 14 33614489 missense probably benign 0.00
R4962:Ptpn20 UTSW 14 33614459 missense probably benign 0.02
R5087:Ptpn20 UTSW 14 33614441 missense possibly damaging 0.90
R5163:Ptpn20 UTSW 14 33631111 missense probably benign 0.07
R6325:Ptpn20 UTSW 14 33631005 missense possibly damaging 0.52
R6651:Ptpn20 UTSW 14 33632940 missense probably damaging 1.00
R6831:Ptpn20 UTSW 14 33632925 missense probably damaging 1.00
R6903:Ptpn20 UTSW 14 33614504 missense probably damaging 0.98
R7034:Ptpn20 UTSW 14 33614435 makesense probably null
R7036:Ptpn20 UTSW 14 33614435 makesense probably null
R7265:Ptpn20 UTSW 14 33614524 missense probably benign 0.05
R7654:Ptpn20 UTSW 14 33638324 missense probably benign 0.18
R7735:Ptpn20 UTSW 14 33630945 missense probably damaging 1.00
R7761:Ptpn20 UTSW 14 33622552 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ACTCAAGGACCATTGCCAG -3'
(R):5'- CACAGTTTGGCTAAACAGAAGTC -3'

Sequencing Primer
(F):5'- GCCAGAAACTATAGAAGACTTTTGGC -3'
(R):5'- CTGACTGGCCTTGAACTTACAGAG -3'
Posted On2016-07-22