Incidental Mutation 'R5275:Pcdh12'
ID403910
Institutional Source Beutler Lab
Gene Symbol Pcdh12
Ensembl Gene ENSMUSG00000024440
Gene Nameprotocadherin 12
SynonymsVE-cadherin-2, vascular endothelial cadherin-2
MMRRC Submission 042838-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5275 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location38267092-38284402 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) T to A at 38284101 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025311] [ENSMUST00000194012]
Predicted Effect probably benign
Transcript: ENSMUST00000025311
SMART Domains Protein: ENSMUSP00000025311
Gene: ENSMUSG00000024440

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CA 53 133 4.42e-2 SMART
CA 157 242 2.55e-17 SMART
CA 266 350 2.31e-24 SMART
CA 376 458 3.86e-26 SMART
CA 482 563 6.27e-26 SMART
CA 621 704 3.02e-2 SMART
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 960 975 N/A INTRINSIC
low complexity region 1032 1041 N/A INTRINSIC
low complexity region 1115 1125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193123
Predicted Effect probably benign
Transcript: ENSMUST00000194012
SMART Domains Protein: ENSMUSP00000141907
Gene: ENSMUSG00000024440

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing 6 cadherin repeats, a transmembrane domain and a cytoplasmic tail that differs from those of the classical cadherins. The gene localizes to the region on chromosome 5 where the protocadherin gene clusters reside. The exon organization of this transcript is similar to that of the gene cluster transcripts, notably the first large exon, but no significant sequence homology exists. The function of this cellular adhesion protein is undetermined but mouse protocadherin 12 does not bind catenins and appears to have no affect on cell migration or growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable, fertile and do not display any obvious histomorphological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,235,659 R155H probably benign Het
Abcc1 C T 16: 14,466,186 L1222F probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Apold1 G T 6: 134,983,800 L72F probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Chd6 A G 2: 160,969,363 L1440P probably benign Het
Clca3a2 A G 3: 144,813,579 S279P probably damaging Het
Cma1 A T 14: 55,941,700 I233N probably damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Dst T C 1: 34,180,148 S1890P probably benign Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm38100 A G 1: 175,920,770 H134R probably benign Het
Gm5117 T A 8: 31,739,567 noncoding transcript Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Gm8909 T C 17: 36,161,675 probably null Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Olfr1309 T A 2: 111,983,829 I82F probably damaging Het
Olfr1344 A T 7: 6,440,016 T39S probably benign Het
Olfr728 T A 14: 50,140,496 I48F probably benign Het
Opa1 C T 16: 29,611,579 T451I probably damaging Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Ppan T A 9: 20,889,773 Y115* probably null Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Ptpn20 A G 14: 33,631,192 H296R probably benign Het
Rergl A G 6: 139,501,821 probably null Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Scfd1 A T 12: 51,415,589 H409L probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Slc24a5 C T 2: 125,085,861 T360I probably benign Het
Snx6 T C 12: 54,784,022 H51R probably damaging Het
Sorl1 A T 9: 42,030,902 V1009D probably benign Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Tlk1 C T 2: 70,752,205 probably benign Het
Tnc G A 4: 63,964,730 Q1885* probably null Het
Vcl T C 14: 21,010,078 V595A probably damaging Het
Vmn1r84 A T 7: 12,361,814 N305K probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Other mutations in Pcdh12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcdh12 APN 18 38281457 missense probably benign
IGL00964:Pcdh12 APN 18 38282731 missense probably benign 0.27
IGL01105:Pcdh12 APN 18 38275347 missense probably damaging 1.00
IGL02011:Pcdh12 APN 18 38281420 missense probably damaging 1.00
IGL02234:Pcdh12 APN 18 38283535 missense probably damaging 1.00
IGL02452:Pcdh12 APN 18 38281693 missense probably benign 0.00
IGL03412:Pcdh12 APN 18 38283515 missense probably benign 0.24
R0729:Pcdh12 UTSW 18 38282464 missense probably benign 0.20
R1330:Pcdh12 UTSW 18 38281861 missense probably benign 0.13
R1394:Pcdh12 UTSW 18 38281189 critical splice donor site probably null
R1413:Pcdh12 UTSW 18 38283443 missense probably damaging 1.00
R1993:Pcdh12 UTSW 18 38282143 missense possibly damaging 0.62
R2115:Pcdh12 UTSW 18 38283986 missense probably damaging 1.00
R2567:Pcdh12 UTSW 18 38282096 missense probably damaging 1.00
R2926:Pcdh12 UTSW 18 38282390 missense probably damaging 0.99
R3810:Pcdh12 UTSW 18 38281237 missense probably damaging 1.00
R3813:Pcdh12 UTSW 18 38283614 nonsense probably null
R5400:Pcdh12 UTSW 18 38268898 missense probably damaging 1.00
R5523:Pcdh12 UTSW 18 38283139 missense probably damaging 1.00
R5539:Pcdh12 UTSW 18 38281744 missense possibly damaging 0.77
R5604:Pcdh12 UTSW 18 38268882 missense probably damaging 1.00
R6012:Pcdh12 UTSW 18 38283752 missense probably damaging 1.00
R6042:Pcdh12 UTSW 18 38281505 missense probably damaging 1.00
R6129:Pcdh12 UTSW 18 38277859 missense probably damaging 1.00
R6239:Pcdh12 UTSW 18 38282401 missense probably damaging 1.00
R6508:Pcdh12 UTSW 18 38281337 nonsense probably null
R7250:Pcdh12 UTSW 18 38281976 missense probably benign
R7259:Pcdh12 UTSW 18 38281624 missense probably benign 0.00
R7271:Pcdh12 UTSW 18 38283047 missense probably damaging 1.00
R7489:Pcdh12 UTSW 18 38281789 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ACAGTTTCCCTATCACCGTG -3'
(R):5'- ACTGCTAAGTGGACCAGCTG -3'

Sequencing Primer
(F):5'- TCCCTATCACCGTGCCAGAC -3'
(R):5'- TCTTCCAGCAATTTATCTGTTCTGGG -3'
Posted On2016-07-22