Mutagenetix > Incidental Mutations

Incidental Mutation 'R5276:Vmn2r23'

403939

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r23

Ensembl Gene

ENSMUSG00000091620

Gene Name

vomeronasal 2, receptor 23

Synonyms

EG435916

MMRRC Submission

042863-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.074) question?

Stock #

R5276 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123702821-123742291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123712977 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 271 (T271A)

Ref Sequence

ENSEMBL: ENSMUSP00000126682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172391]

AlphaFold

E9PXI5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172391
AA Change: T271A

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: T271A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	79	461	1.7e-31	PFAM
Pfam:NCD3G	513	566	1.2e-23	PFAM
Pfam:7tm_3	596	834	1.5e-55	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26a	A	G	8: 43,570,420	F11S	probably benign	Het
Adipor2	T	A	6: 119,357,221	I343F	probably damaging	Het
Ahdc1	C	T	4: 133,062,798	P450L	possibly damaging	Het
Akna	A	C	4: 63,368,203	V1353G	possibly damaging	Het
Baz2b	G	A	2: 59,962,614	T390I	probably benign	Het
Btbd7	T	C	12: 102,838,392	K130E	probably benign	Het
Cdc42bpa	A	G	1: 180,137,850	Y1101C	probably damaging	Het
Crlf2	T	G	5: 109,557,635		probably benign	Het
Ddx59	A	T	1: 136,419,448	R281S	probably damaging	Het
Dgcr8	T	G	16: 18,283,771	T216P	probably benign	Het
Dsg4	A	T	18: 20,446,839	I34F	probably benign	Het
Enpp3	A	G	10: 24,809,916	S194P	probably damaging	Het
Entpd8	C	T	2: 25,085,045	R463W	probably benign	Het
Fam169a	A	G	13: 97,118,496	T407A	probably benign	Het
Fam98b	G	T	2: 117,259,298	V99F	possibly damaging	Het
Foxn3	T	A	12: 99,196,428	K405*	probably null	Het
Gm340	T	A	19: 41,585,039	H744Q	probably damaging	Het
Gsdmc	T	C	15: 63,801,957	T160A	probably benign	Het
Hdac1	T	C	4: 129,528,923		probably null	Het
Igfbp1	A	C	11: 7,201,892	T232P	probably damaging	Het
Mertk	G	C	2: 128,801,314	G878R	possibly damaging	Het
Metap2	G	T	10: 93,868,922	P281H	possibly damaging	Het
Metap2	T	A	10: 93,868,932	T278S	probably benign	Het
Mfn1	T	C	3: 32,564,205	V169A	probably benign	Het
Mms22l	A	G	4: 24,578,774	D751G	probably damaging	Het
Mpl	A	G	4: 118,455,721	V138A	probably benign	Het
Myef2	T	A	2: 125,095,721	K533N	probably damaging	Het
Mylk3	C	T	8: 85,355,442	G309E	probably damaging	Het
Nid1	T	C	13: 13,468,572	V365A	probably damaging	Het
Olfr27	T	C	9: 39,144,315	C72R	probably damaging	Het
Olfr463	A	T	11: 87,893,192	I244N	probably damaging	Het
Olfr480	A	T	7: 108,066,216	L164*	probably null	Het
Olfr77	C	A	9: 19,920,621	N137K	possibly damaging	Het
Pbrm1	A	G	14: 31,106,184	K1323E	probably damaging	Het
Pcdhga12	G	A	18: 37,766,675	D187N	possibly damaging	Het
Phrf1	T	C	7: 141,259,283		probably benign	Het
Phtf2	A	G	5: 20,772,197	V608A	probably benign	Het
Plec	G	A	15: 76,173,438	R4122W	probably damaging	Het
Polm	A	G	11: 5,829,393	S441P	probably benign	Het
Prrc2b	T	A	2: 32,214,722	V1404E	probably benign	Het
Ptger1	T	G	8: 83,669,345	S344A	possibly damaging	Het
Rasef	A	T	4: 73,735,767	D401E	probably null	Het
Rbfox3	T	C	11: 118,496,352	Y312C	probably damaging	Het
Rbm48	A	G	5: 3,584,759	C402R	probably benign	Het
Rhbdl3	G	A	11: 80,319,666	A82T	probably benign	Het
Rnf123	AT	ATT	9: 108,064,003		probably null	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Homo
Sidt2	T	A	9: 45,954,777	N44Y	probably damaging	Het
Slf2	T	A	19: 44,935,161	L138Q	possibly damaging	Het
Spag16	T	C	1: 69,896,583		probably null	Het
Sspo	C	T	6: 48,490,467	P4188S	probably damaging	Het
Synm	C	T	7: 67,734,689	S1075N	probably benign	Het
Tacc2	G	T	7: 130,729,317	D2151Y	probably damaging	Het
Tbc1d32	C	A	10: 56,151,818	L729F	probably damaging	Het
Tnfsf4	A	G	1: 161,417,013	N91S	possibly damaging	Het
Trim63	G	A	4: 134,323,133	E243K	probably benign	Het
Trim72	T	G	7: 128,004,542	L20R	probably damaging	Het
Tubb1	A	G	2: 174,457,424	M300V	probably damaging	Het
Ubfd1	C	T	7: 122,068,868	A207V	probably damaging	Het
Usp16	T	A	16: 87,470,451		probably null	Het
Vmn2r72	T	A	7: 85,738,254	I701F	possibly damaging	Het
Wdfy4	A	G	14: 33,047,275	Y2078H	probably damaging	Het
Wdr41	T	C	13: 95,017,450		probably null	Het
Zfp955b	A	G	17: 33,303,057	Y500C	probably damaging	Het

Other mutations in Vmn2r23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Vmn2r23	APN	6	123729725	missense	possibly damaging	0.89
IGL01012:Vmn2r23	APN	6	123729596	missense	probably benign
IGL01073:Vmn2r23	APN	6	123712800	missense	possibly damaging	0.82
IGL01547:Vmn2r23	APN	6	123704424	missense	possibly damaging	0.88
IGL01571:Vmn2r23	APN	6	123704407	missense	probably damaging	1.00
IGL01950:Vmn2r23	APN	6	123741886	missense	possibly damaging	0.80
IGL02028:Vmn2r23	APN	6	123741860	missense	probably damaging	1.00
IGL02248:Vmn2r23	APN	6	123741744	missense	probably damaging	0.96
IGL02318:Vmn2r23	APN	6	123741836	missense	probably benign	0.10
IGL02649:Vmn2r23	APN	6	123704478	missense	probably benign
IGL02831:Vmn2r23	APN	6	123704385	missense	probably benign	0.22
IGL02832:Vmn2r23	APN	6	123704396	missense	probably benign	0.00
IGL02865:Vmn2r23	APN	6	123741619	missense	probably damaging	1.00
IGL02964:Vmn2r23	APN	6	123741782	missense	possibly damaging	0.93
IGL03347:Vmn2r23	APN	6	123704374	missense	probably benign	0.01
IGL03396:Vmn2r23	APN	6	123729626	missense	probably damaging	1.00
PIT4472001:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R0597:Vmn2r23	UTSW	6	123729721	missense	probably benign	0.08
R0677:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R0904:Vmn2r23	UTSW	6	123742135	missense	probably damaging	1.00
R1330:Vmn2r23	UTSW	6	123742004	missense	probably damaging	1.00
R1424:Vmn2r23	UTSW	6	123713270	nonsense	probably null
R1629:Vmn2r23	UTSW	6	123713427	missense	probably benign	0.05
R1842:Vmn2r23	UTSW	6	123729690	missense	possibly damaging	0.77
R1867:Vmn2r23	UTSW	6	123702915	missense	probably damaging	1.00
R1919:Vmn2r23	UTSW	6	123713010	missense	possibly damaging	0.94
R2087:Vmn2r23	UTSW	6	123741499	missense	probably benign	0.00
R2338:Vmn2r23	UTSW	6	123704425	missense	possibly damaging	0.88
R2568:Vmn2r23	UTSW	6	123742188	nonsense	probably null
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R3500:Vmn2r23	UTSW	6	123713170	missense	possibly damaging	0.81
R3789:Vmn2r23	UTSW	6	123741389	missense	probably damaging	1.00
R4164:Vmn2r23	UTSW	6	123729738	missense	probably benign
R4506:Vmn2r23	UTSW	6	123702925	missense	probably damaging	1.00
R4652:Vmn2r23	UTSW	6	123741730	missense	probably damaging	1.00
R4697:Vmn2r23	UTSW	6	123741826	missense	probably damaging	1.00
R4840:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R4983:Vmn2r23	UTSW	6	123733349	missense	probably damaging	1.00
R5392:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R5528:Vmn2r23	UTSW	6	123713002	missense	probably damaging	1.00
R5529:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R5664:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R5749:Vmn2r23	UTSW	6	123733273	missense	probably benign
R5761:Vmn2r23	UTSW	6	123712759	missense	probably benign	0.39
R5762:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R5868:Vmn2r23	UTSW	6	123712942	missense	probably benign	0.12
R5935:Vmn2r23	UTSW	6	123741895	missense	possibly damaging	0.94
R6242:Vmn2r23	UTSW	6	123704400	missense	possibly damaging	0.82
R6416:Vmn2r23	UTSW	6	123712902	missense	probably damaging	1.00
R6524:Vmn2r23	UTSW	6	123713425	missense	probably damaging	1.00
R6576:Vmn2r23	UTSW	6	123733273	missense	probably benign
R6925:Vmn2r23	UTSW	6	123704553	missense	probably damaging	1.00
R7148:Vmn2r23	UTSW	6	123713022	missense	probably benign
R7215:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R7252:Vmn2r23	UTSW	6	123741581	missense	probably damaging	0.97
R7403:Vmn2r23	UTSW	6	123704579	missense	probably benign	0.01
R8015:Vmn2r23	UTSW	6	123704541	missense	probably benign	0.00
R8143:Vmn2r23	UTSW	6	123741353	missense	probably damaging	0.99
R8474:Vmn2r23	UTSW	6	123704640	missense	probably benign	0.36
R8520:Vmn2r23	UTSW	6	123741656	missense	probably damaging	0.99
R8679:Vmn2r23	UTSW	6	123713472	missense	probably damaging	0.99
R8713:Vmn2r23	UTSW	6	123703032	missense
R8966:Vmn2r23	UTSW	6	123742120	missense	possibly damaging	0.94
RF018:Vmn2r23	UTSW	6	123713116	missense	probably benign	0.00
T0975:Vmn2r23	UTSW	6	123713161	missense	probably benign	0.00
Z1088:Vmn2r23	UTSW	6	123742108	missense	probably damaging	0.98
Z1177:Vmn2r23	UTSW	6	123729725	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ACCACAGCTCTGTATCAGGG -3'
(R):5'- ATCCCAGAATTTCATCCATGTGAAC -3'

Sequencing Primer
(F):5'- CAGGGAATTATTCAACTGCTGC -3'
(R):5'- CAATCAGACGTTGTGATCC -3'

Posted On

2016-07-22