Incidental Mutation 'R5276:Olfr480'
ID403943
Institutional Source Beutler Lab
Gene Symbol Olfr480
Ensembl Gene ENSMUSG00000063120
Gene Nameolfactory receptor 480
SynonymsGA_x6K02T2PBJ9-10395807-10394869, MOR204-32
MMRRC Submission 042863-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R5276 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108064878-108067346 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 108066216 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 164 (L164*)
Ref Sequence ENSEMBL: ENSMUSP00000149301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071658] [ENSMUST00000217653]
Predicted Effect probably null
Transcript: ENSMUST00000071658
AA Change: L194*
SMART Domains Protein: ENSMUSP00000071583
Gene: ENSMUSG00000063120
AA Change: L194*

DomainStartEndE-ValueType
Pfam:7tm_4 61 338 1.7e-50 PFAM
Pfam:7tm_1 71 320 1.4e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000084760
AA Change: L164*
SMART Domains Protein: ENSMUSP00000081815
Gene: ENSMUSG00000063120
AA Change: L164*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-49 PFAM
Pfam:7tm_1 41 290 8.1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217653
AA Change: L164*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A G 8: 43,570,420 F11S probably benign Het
Adipor2 T A 6: 119,357,221 I343F probably damaging Het
Ahdc1 C T 4: 133,062,798 P450L possibly damaging Het
Akna A C 4: 63,368,203 V1353G possibly damaging Het
Baz2b G A 2: 59,962,614 T390I probably benign Het
Btbd7 T C 12: 102,838,392 K130E probably benign Het
Cdc42bpa A G 1: 180,137,850 Y1101C probably damaging Het
Crlf2 T G 5: 109,557,635 probably benign Het
Ddx59 A T 1: 136,419,448 R281S probably damaging Het
Dgcr8 T G 16: 18,283,771 T216P probably benign Het
Dsg4 A T 18: 20,446,839 I34F probably benign Het
Enpp3 A G 10: 24,809,916 S194P probably damaging Het
Entpd8 C T 2: 25,085,045 R463W probably benign Het
Fam169a A G 13: 97,118,496 T407A probably benign Het
Fam98b G T 2: 117,259,298 V99F possibly damaging Het
Foxn3 T A 12: 99,196,428 K405* probably null Het
Gm340 T A 19: 41,585,039 H744Q probably damaging Het
Gsdmc T C 15: 63,801,957 T160A probably benign Het
Hdac1 T C 4: 129,528,923 probably null Het
Igfbp1 A C 11: 7,201,892 T232P probably damaging Het
Mertk G C 2: 128,801,314 G878R possibly damaging Het
Metap2 G T 10: 93,868,922 P281H possibly damaging Het
Metap2 T A 10: 93,868,932 T278S probably benign Het
Mfn1 T C 3: 32,564,205 V169A probably benign Het
Mms22l A G 4: 24,578,774 D751G probably damaging Het
Mpl A G 4: 118,455,721 V138A probably benign Het
Myef2 T A 2: 125,095,721 K533N probably damaging Het
Mylk3 C T 8: 85,355,442 G309E probably damaging Het
Nid1 T C 13: 13,468,572 V365A probably damaging Het
Olfr27 T C 9: 39,144,315 C72R probably damaging Het
Olfr463 A T 11: 87,893,192 I244N probably damaging Het
Olfr77 C A 9: 19,920,621 N137K possibly damaging Het
Pbrm1 A G 14: 31,106,184 K1323E probably damaging Het
Pcdhga12 G A 18: 37,766,675 D187N possibly damaging Het
Phrf1 T C 7: 141,259,283 probably benign Het
Phtf2 A G 5: 20,772,197 V608A probably benign Het
Plec G A 15: 76,173,438 R4122W probably damaging Het
Polm A G 11: 5,829,393 S441P probably benign Het
Prrc2b T A 2: 32,214,722 V1404E probably benign Het
Ptger1 T G 8: 83,669,345 S344A possibly damaging Het
Rasef A T 4: 73,735,767 D401E probably null Het
Rbfox3 T C 11: 118,496,352 Y312C probably damaging Het
Rbm48 A G 5: 3,584,759 C402R probably benign Het
Rhbdl3 G A 11: 80,319,666 A82T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sidt2 T A 9: 45,954,777 N44Y probably damaging Het
Slf2 T A 19: 44,935,161 L138Q possibly damaging Het
Spag16 T C 1: 69,896,583 probably null Het
Sspo C T 6: 48,490,467 P4188S probably damaging Het
Synm C T 7: 67,734,689 S1075N probably benign Het
Tacc2 G T 7: 130,729,317 D2151Y probably damaging Het
Tbc1d32 C A 10: 56,151,818 L729F probably damaging Het
Tnfsf4 A G 1: 161,417,013 N91S possibly damaging Het
Trim63 G A 4: 134,323,133 E243K probably benign Het
Trim72 T G 7: 128,004,542 L20R probably damaging Het
Tubb1 A G 2: 174,457,424 M300V probably damaging Het
Ubfd1 C T 7: 122,068,868 A207V probably damaging Het
Usp16 T A 16: 87,470,451 probably null Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Vmn2r72 T A 7: 85,738,254 I701F possibly damaging Het
Wdfy4 A G 14: 33,047,275 Y2078H probably damaging Het
Wdr41 T C 13: 95,017,450 probably null Het
Zfp955b A G 17: 33,303,057 Y500C probably damaging Het
Other mutations in Olfr480
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Olfr480 APN 7 108066288 missense probably benign 0.32
IGL02060:Olfr480 APN 7 108066671 missense probably benign 0.03
IGL02392:Olfr480 APN 7 108066503 missense probably benign 0.10
IGL02493:Olfr480 APN 7 108065805 missense possibly damaging 0.79
IGL02634:Olfr480 APN 7 108066771 missense probably benign 0.00
F5770:Olfr480 UTSW 7 108066678 missense probably benign 0.11
R0446:Olfr480 UTSW 7 108066725 nonsense probably null
R1070:Olfr480 UTSW 7 108066651 missense probably benign 0.00
R1510:Olfr480 UTSW 7 108066528 missense probably damaging 1.00
R1862:Olfr480 UTSW 7 108066725 nonsense probably null
R1863:Olfr480 UTSW 7 108066725 nonsense probably null
R1885:Olfr480 UTSW 7 108066778 missense probably benign 0.00
R1886:Olfr480 UTSW 7 108066778 missense probably benign 0.00
R1887:Olfr480 UTSW 7 108066778 missense probably benign 0.00
R3609:Olfr480 UTSW 7 108066369 missense probably damaging 1.00
R3921:Olfr480 UTSW 7 108065901 missense possibly damaging 0.94
R4259:Olfr480 UTSW 7 108065893 nonsense probably null
R6224:Olfr480 UTSW 7 108066742 missense probably benign 0.00
R8059:Olfr480 UTSW 7 108066016 missense probably benign 0.01
R8229:Olfr480 UTSW 7 108066587 missense probably benign 0.01
R8271:Olfr480 UTSW 7 108065773 missense probably damaging 0.99
R8926:Olfr480 UTSW 7 108066306 missense probably benign 0.06
V7581:Olfr480 UTSW 7 108066678 missense probably benign 0.11
X0021:Olfr480 UTSW 7 108066588 missense probably benign 0.01
X0066:Olfr480 UTSW 7 108066435 missense probably benign 0.00
Z1088:Olfr480 UTSW 7 108066327 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCGCATCTTCAGGATTGACAC -3'
(R):5'- ACATTTATCCCTGTGGCTGG -3'

Sequencing Primer
(F):5'- CATCTTCAGGATTGACACAAGGATG -3'
(R):5'- CTGGCTGTGTGGCTCAACTC -3'
Posted On2016-07-22