Incidental Mutation 'R5276:Trim72'
ID403945
Institutional Source Beutler Lab
Gene Symbol Trim72
Ensembl Gene ENSMUSG00000042828
Gene Nametripartite motif-containing 72
Synonymsmitsugumin 53, MG53
MMRRC Submission 042863-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R5276 (G1)
Quality Score220
Status Not validated
Chromosome7
Chromosomal Location128003949-128011033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 128004542 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 20 (L20R)
Ref Sequence ENSEMBL: ENSMUSP00000101855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081042] [ENSMUST00000106248]
Predicted Effect probably damaging
Transcript: ENSMUST00000081042
AA Change: L20R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079832
Gene: ENSMUSG00000042828
AA Change: L20R

DomainStartEndE-ValueType
RING 14 56 5.14e-7 SMART
BBOX 81 122 3.89e-7 SMART
coiled coil region 135 169 N/A INTRINSIC
coiled coil region 204 232 N/A INTRINSIC
PRY 288 341 6.48e-13 SMART
Pfam:SPRY 342 472 4.9e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106248
AA Change: L20R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101855
Gene: ENSMUSG00000042828
AA Change: L20R

DomainStartEndE-ValueType
RING 14 56 5.14e-7 SMART
BBOX 81 122 3.89e-7 SMART
coiled coil region 135 169 N/A INTRINSIC
coiled coil region 204 232 N/A INTRINSIC
PRY 288 341 6.48e-13 SMART
Pfam:SPRY 344 465 1.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206216
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice with disruption of this gene display muscle pathologies that develop with age. Mice homozygous for a knock-out allele exhibit enhanced myogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A G 8: 43,570,420 F11S probably benign Het
Adipor2 T A 6: 119,357,221 I343F probably damaging Het
Ahdc1 C T 4: 133,062,798 P450L possibly damaging Het
Akna A C 4: 63,368,203 V1353G possibly damaging Het
Baz2b G A 2: 59,962,614 T390I probably benign Het
Btbd7 T C 12: 102,838,392 K130E probably benign Het
Cdc42bpa A G 1: 180,137,850 Y1101C probably damaging Het
Crlf2 T G 5: 109,557,635 probably benign Het
Ddx59 A T 1: 136,419,448 R281S probably damaging Het
Dgcr8 T G 16: 18,283,771 T216P probably benign Het
Dsg4 A T 18: 20,446,839 I34F probably benign Het
Enpp3 A G 10: 24,809,916 S194P probably damaging Het
Entpd8 C T 2: 25,085,045 R463W probably benign Het
Fam169a A G 13: 97,118,496 T407A probably benign Het
Fam98b G T 2: 117,259,298 V99F possibly damaging Het
Foxn3 T A 12: 99,196,428 K405* probably null Het
Gm340 T A 19: 41,585,039 H744Q probably damaging Het
Gsdmc T C 15: 63,801,957 T160A probably benign Het
Hdac1 T C 4: 129,528,923 probably null Het
Igfbp1 A C 11: 7,201,892 T232P probably damaging Het
Mertk G C 2: 128,801,314 G878R possibly damaging Het
Metap2 G T 10: 93,868,922 P281H possibly damaging Het
Metap2 T A 10: 93,868,932 T278S probably benign Het
Mfn1 T C 3: 32,564,205 V169A probably benign Het
Mms22l A G 4: 24,578,774 D751G probably damaging Het
Mpl A G 4: 118,455,721 V138A probably benign Het
Myef2 T A 2: 125,095,721 K533N probably damaging Het
Mylk3 C T 8: 85,355,442 G309E probably damaging Het
Nid1 T C 13: 13,468,572 V365A probably damaging Het
Olfr27 T C 9: 39,144,315 C72R probably damaging Het
Olfr463 A T 11: 87,893,192 I244N probably damaging Het
Olfr480 A T 7: 108,066,216 L164* probably null Het
Olfr77 C A 9: 19,920,621 N137K possibly damaging Het
Pbrm1 A G 14: 31,106,184 K1323E probably damaging Het
Pcdhga12 G A 18: 37,766,675 D187N possibly damaging Het
Phrf1 T C 7: 141,259,283 probably benign Het
Phtf2 A G 5: 20,772,197 V608A probably benign Het
Plec G A 15: 76,173,438 R4122W probably damaging Het
Polm A G 11: 5,829,393 S441P probably benign Het
Prrc2b T A 2: 32,214,722 V1404E probably benign Het
Ptger1 T G 8: 83,669,345 S344A possibly damaging Het
Rasef A T 4: 73,735,767 D401E probably null Het
Rbfox3 T C 11: 118,496,352 Y312C probably damaging Het
Rbm48 A G 5: 3,584,759 C402R probably benign Het
Rhbdl3 G A 11: 80,319,666 A82T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sidt2 T A 9: 45,954,777 N44Y probably damaging Het
Slf2 T A 19: 44,935,161 L138Q possibly damaging Het
Spag16 T C 1: 69,896,583 probably null Het
Sspo C T 6: 48,490,467 P4188S probably damaging Het
Synm C T 7: 67,734,689 S1075N probably benign Het
Tacc2 G T 7: 130,729,317 D2151Y probably damaging Het
Tbc1d32 C A 10: 56,151,818 L729F probably damaging Het
Tnfsf4 A G 1: 161,417,013 N91S possibly damaging Het
Trim63 G A 4: 134,323,133 E243K probably benign Het
Tubb1 A G 2: 174,457,424 M300V probably damaging Het
Ubfd1 C T 7: 122,068,868 A207V probably damaging Het
Usp16 T A 16: 87,470,451 probably null Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Vmn2r72 T A 7: 85,738,254 I701F possibly damaging Het
Wdfy4 A G 14: 33,047,275 Y2078H probably damaging Het
Wdr41 T C 13: 95,017,450 probably null Het
Zfp955b A G 17: 33,303,057 Y500C probably damaging Het
Other mutations in Trim72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02195:Trim72 APN 7 128007964 missense probably damaging 0.97
IGL02538:Trim72 APN 7 128004770 missense probably damaging 1.00
IGL02794:Trim72 APN 7 128004532 missense probably damaging 1.00
IGL03077:Trim72 APN 7 128007841 missense probably benign
H8786:Trim72 UTSW 7 128004791 missense probably damaging 0.99
R1101:Trim72 UTSW 7 128010247 missense possibly damaging 0.94
R1711:Trim72 UTSW 7 128004585 missense probably damaging 1.00
R1826:Trim72 UTSW 7 128007844 missense possibly damaging 0.59
R1853:Trim72 UTSW 7 128009082 missense probably benign 0.01
R1854:Trim72 UTSW 7 128009082 missense probably benign 0.01
R2513:Trim72 UTSW 7 128004706 missense possibly damaging 0.93
R4163:Trim72 UTSW 7 128007908 missense probably benign 0.05
R4587:Trim72 UTSW 7 128007992 missense probably benign 0.21
R5027:Trim72 UTSW 7 128007965 missense probably damaging 0.99
R5067:Trim72 UTSW 7 128009967 missense possibly damaging 0.86
R5290:Trim72 UTSW 7 128010004 missense probably benign 0.03
R5339:Trim72 UTSW 7 128010333 missense probably benign
R5410:Trim72 UTSW 7 128009923 missense probably damaging 1.00
R6301:Trim72 UTSW 7 128004614 missense possibly damaging 0.93
R6594:Trim72 UTSW 7 128010048 missense probably damaging 1.00
R6774:Trim72 UTSW 7 128010386 missense probably damaging 1.00
R7162:Trim72 UTSW 7 128007649 missense probably benign 0.18
R7372:Trim72 UTSW 7 128004686 missense possibly damaging 0.63
R7937:Trim72 UTSW 7 128010319 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCAGATTCTCTTCCAGTGTGGG -3'
(R):5'- AGTGGATCCAGGTGTTCCTC -3'

Sequencing Primer
(F):5'- ATTCTCTTCCAGTGTGGGATGTGAG -3'
(R):5'- ATCCAGGTGTTCCTCGCAGTG -3'
Posted On2016-07-22