Incidental Mutation 'R5276:Phrf1'
ID 403947
Institutional Source Beutler Lab
Gene Symbol Phrf1
Ensembl Gene ENSMUSG00000038611
Gene Name PHD and ring finger domains 1
Synonyms
MMRRC Submission 042863-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5276 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 140808697-140842663 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 140839196 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026571] [ENSMUST00000097952] [ENSMUST00000106023] [ENSMUST00000106027] [ENSMUST00000122143] [ENSMUST00000209899] [ENSMUST00000132540] [ENSMUST00000155123]
AlphaFold A6H619
Predicted Effect probably benign
Transcript: ENSMUST00000026571
SMART Domains Protein: ENSMUSP00000026571
Gene: ENSMUSG00000025498

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 240 420 1.38e-63 SMART
low complexity region 425 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097952
SMART Domains Protein: ENSMUSP00000095565
Gene: ENSMUSG00000025498

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 209 389 1.38e-63 SMART
low complexity region 394 411 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106023
SMART Domains Protein: ENSMUSP00000101644
Gene: ENSMUSG00000025498

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 208 388 1.38e-63 SMART
low complexity region 393 410 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000106027
AA Change: V956A
SMART Domains Protein: ENSMUSP00000101648
Gene: ENSMUSG00000038611
AA Change: V956A

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
C1 173 229 7.05e-2 SMART
PHD 187 233 1.77e-14 SMART
RING 188 232 3.17e0 SMART
low complexity region 332 369 N/A INTRINSIC
low complexity region 491 505 N/A INTRINSIC
low complexity region 507 522 N/A INTRINSIC
low complexity region 717 728 N/A INTRINSIC
low complexity region 831 857 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 944 955 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 999 1020 N/A INTRINSIC
low complexity region 1027 1043 N/A INTRINSIC
low complexity region 1051 1090 N/A INTRINSIC
low complexity region 1094 1151 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1217 1241 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
low complexity region 1288 1306 N/A INTRINSIC
low complexity region 1308 1319 N/A INTRINSIC
low complexity region 1359 1376 N/A INTRINSIC
low complexity region 1426 1441 N/A INTRINSIC
low complexity region 1575 1592 N/A INTRINSIC
Blast:IG_like 1593 1636 4e-14 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000122143
AA Change: V797A
SMART Domains Protein: ENSMUSP00000113195
Gene: ENSMUSG00000038611
AA Change: V797A

DomainStartEndE-ValueType
C1 14 70 7.05e-2 SMART
PHD 28 74 1.77e-14 SMART
low complexity region 173 210 N/A INTRINSIC
low complexity region 332 346 N/A INTRINSIC
low complexity region 348 363 N/A INTRINSIC
low complexity region 558 569 N/A INTRINSIC
low complexity region 672 698 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 840 861 N/A INTRINSIC
low complexity region 868 884 N/A INTRINSIC
low complexity region 892 931 N/A INTRINSIC
low complexity region 935 992 N/A INTRINSIC
low complexity region 1001 1014 N/A INTRINSIC
low complexity region 1058 1082 N/A INTRINSIC
low complexity region 1086 1102 N/A INTRINSIC
low complexity region 1129 1147 N/A INTRINSIC
low complexity region 1149 1160 N/A INTRINSIC
low complexity region 1200 1217 N/A INTRINSIC
low complexity region 1267 1282 N/A INTRINSIC
low complexity region 1416 1433 N/A INTRINSIC
Blast:IG_like 1434 1477 4e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122868
Predicted Effect unknown
Transcript: ENSMUST00000142572
AA Change: V31A
SMART Domains Protein: ENSMUSP00000117393
Gene: ENSMUSG00000038611
AA Change: V31A

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 41 52 N/A INTRINSIC
low complexity region 75 96 N/A INTRINSIC
low complexity region 103 119 N/A INTRINSIC
low complexity region 127 166 N/A INTRINSIC
low complexity region 170 227 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 293 317 N/A INTRINSIC
low complexity region 321 337 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 384 395 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
low complexity region 666 683 N/A INTRINSIC
Blast:IG_like 684 727 3e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155744
Predicted Effect probably benign
Transcript: ENSMUST00000209899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127223
Predicted Effect probably benign
Transcript: ENSMUST00000132540
Predicted Effect probably benign
Transcript: ENSMUST00000155123
SMART Domains Protein: ENSMUSP00000120759
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
Blast:C1 165 209 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123525
SMART Domains Protein: ENSMUSP00000121026
Gene: ENSMUSG00000025498

DomainStartEndE-ValueType
IRF 1 69 6.35e-3 SMART
IRF-3 77 251 2.62e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130687
SMART Domains Protein: ENSMUSP00000123351
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 100 115 N/A INTRINSIC
low complexity region 224 241 N/A INTRINSIC
Blast:IG_like 242 285 5e-15 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A G 8: 44,023,457 (GRCm39) F11S probably benign Het
Adipor2 T A 6: 119,334,182 (GRCm39) I343F probably damaging Het
Ahdc1 C T 4: 132,790,109 (GRCm39) P450L possibly damaging Het
Akna A C 4: 63,286,440 (GRCm39) V1353G possibly damaging Het
Baz2b G A 2: 59,792,958 (GRCm39) T390I probably benign Het
Btbd7 T C 12: 102,804,651 (GRCm39) K130E probably benign Het
Cdc42bpa A G 1: 179,965,415 (GRCm39) Y1101C probably damaging Het
Crlf2 T G 5: 109,705,501 (GRCm39) probably benign Het
Ddx59 A T 1: 136,347,186 (GRCm39) R281S probably damaging Het
Dgcr8 T G 16: 18,101,635 (GRCm39) T216P probably benign Het
Dsg4 A T 18: 20,579,896 (GRCm39) I34F probably benign Het
Enpp3 A G 10: 24,685,814 (GRCm39) S194P probably damaging Het
Entpd8 C T 2: 24,975,057 (GRCm39) R463W probably benign Het
Fam169a A G 13: 97,255,004 (GRCm39) T407A probably benign Het
Fam98b G T 2: 117,089,779 (GRCm39) V99F possibly damaging Het
Foxn3 T A 12: 99,162,687 (GRCm39) K405* probably null Het
Gsdmc T C 15: 63,673,806 (GRCm39) T160A probably benign Het
Hdac1 T C 4: 129,422,716 (GRCm39) probably null Het
Igfbp1 A C 11: 7,151,892 (GRCm39) T232P probably damaging Het
Lcor T A 19: 41,573,478 (GRCm39) H744Q probably damaging Het
Mertk G C 2: 128,643,234 (GRCm39) G878R possibly damaging Het
Metap2 G T 10: 93,704,784 (GRCm39) P281H possibly damaging Het
Metap2 T A 10: 93,704,794 (GRCm39) T278S probably benign Het
Mfn1 T C 3: 32,618,354 (GRCm39) V169A probably benign Het
Mms22l A G 4: 24,578,774 (GRCm39) D751G probably damaging Het
Mpl A G 4: 118,312,918 (GRCm39) V138A probably benign Het
Myef2 T A 2: 124,937,641 (GRCm39) K533N probably damaging Het
Mylk3 C T 8: 86,082,071 (GRCm39) G309E probably damaging Het
Nid1 T C 13: 13,643,157 (GRCm39) V365A probably damaging Het
Or4d2 A T 11: 87,784,018 (GRCm39) I244N probably damaging Het
Or5p57 A T 7: 107,665,423 (GRCm39) L164* probably null Het
Or7d10 C A 9: 19,831,917 (GRCm39) N137K possibly damaging Het
Or8g19 T C 9: 39,055,611 (GRCm39) C72R probably damaging Het
Pbrm1 A G 14: 30,828,141 (GRCm39) K1323E probably damaging Het
Pcdhga12 G A 18: 37,899,728 (GRCm39) D187N possibly damaging Het
Phtf2 A G 5: 20,977,195 (GRCm39) V608A probably benign Het
Plec G A 15: 76,057,638 (GRCm39) R4122W probably damaging Het
Polm A G 11: 5,779,393 (GRCm39) S441P probably benign Het
Prrc2b T A 2: 32,104,734 (GRCm39) V1404E probably benign Het
Ptger1 T G 8: 84,395,974 (GRCm39) S344A possibly damaging Het
Rasef A T 4: 73,654,004 (GRCm39) D401E probably null Het
Rbfox3 T C 11: 118,387,178 (GRCm39) Y312C probably damaging Het
Rbm48 A G 5: 3,634,759 (GRCm39) C402R probably benign Het
Rhbdl3 G A 11: 80,210,492 (GRCm39) A82T probably benign Het
Rnf123 AT ATT 9: 107,941,202 (GRCm39) probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,103,384 (GRCm39) probably benign Homo
Sidt2 T A 9: 45,866,075 (GRCm39) N44Y probably damaging Het
Slf2 T A 19: 44,923,600 (GRCm39) L138Q possibly damaging Het
Spag16 T C 1: 69,935,742 (GRCm39) probably null Het
Sspo C T 6: 48,467,401 (GRCm39) P4188S probably damaging Het
Synm C T 7: 67,384,437 (GRCm39) S1075N probably benign Het
Tacc2 G T 7: 130,331,047 (GRCm39) D2151Y probably damaging Het
Tbc1d32 C A 10: 56,027,914 (GRCm39) L729F probably damaging Het
Tnfsf4 A G 1: 161,244,584 (GRCm39) N91S possibly damaging Het
Trim63 G A 4: 134,050,444 (GRCm39) E243K probably benign Het
Trim72 T G 7: 127,603,714 (GRCm39) L20R probably damaging Het
Tubb1 A G 2: 174,299,217 (GRCm39) M300V probably damaging Het
Ubfd1 C T 7: 121,668,091 (GRCm39) A207V probably damaging Het
Usp16 T A 16: 87,267,339 (GRCm39) probably null Het
Vmn2r23 A G 6: 123,689,936 (GRCm39) T271A possibly damaging Het
Vmn2r72 T A 7: 85,387,462 (GRCm39) I701F possibly damaging Het
Wdfy4 A G 14: 32,769,232 (GRCm39) Y2078H probably damaging Het
Wdr41 T C 13: 95,153,958 (GRCm39) probably null Het
Zfp955b A G 17: 33,522,031 (GRCm39) Y500C probably damaging Het
Other mutations in Phrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Phrf1 APN 7 140,838,790 (GRCm39) unclassified probably benign
IGL01391:Phrf1 APN 7 140,842,394 (GRCm39) missense probably damaging 1.00
IGL01472:Phrf1 APN 7 140,836,403 (GRCm39) splice site probably benign
IGL01633:Phrf1 APN 7 140,840,413 (GRCm39) missense probably benign 0.43
IGL01808:Phrf1 APN 7 140,840,879 (GRCm39) missense probably damaging 1.00
IGL02004:Phrf1 APN 7 140,840,246 (GRCm39) missense probably benign 0.39
IGL02138:Phrf1 APN 7 140,839,196 (GRCm39) unclassified probably benign
IGL02678:Phrf1 APN 7 140,840,195 (GRCm39) missense probably damaging 1.00
IGL03077:Phrf1 APN 7 140,834,881 (GRCm39) nonsense probably null
PIT4466001:Phrf1 UTSW 7 140,838,725 (GRCm39) missense unknown
R0036:Phrf1 UTSW 7 140,841,693 (GRCm39) missense probably damaging 1.00
R0036:Phrf1 UTSW 7 140,841,693 (GRCm39) missense probably damaging 1.00
R0040:Phrf1 UTSW 7 140,823,770 (GRCm39) missense probably damaging 1.00
R0358:Phrf1 UTSW 7 140,838,217 (GRCm39) unclassified probably benign
R0445:Phrf1 UTSW 7 140,827,244 (GRCm39) utr 3 prime probably benign
R0535:Phrf1 UTSW 7 140,839,978 (GRCm39) missense probably benign 0.07
R0561:Phrf1 UTSW 7 140,834,876 (GRCm39) missense probably benign 0.00
R0940:Phrf1 UTSW 7 140,834,768 (GRCm39) splice site probably benign
R1499:Phrf1 UTSW 7 140,836,564 (GRCm39) missense probably damaging 1.00
R1511:Phrf1 UTSW 7 140,839,714 (GRCm39) unclassified probably benign
R1651:Phrf1 UTSW 7 140,817,434 (GRCm39) missense probably benign
R1691:Phrf1 UTSW 7 140,841,787 (GRCm39) nonsense probably null
R1778:Phrf1 UTSW 7 140,812,369 (GRCm39) missense probably benign 0.01
R1851:Phrf1 UTSW 7 140,820,831 (GRCm39) missense probably damaging 1.00
R2239:Phrf1 UTSW 7 140,817,605 (GRCm39) missense probably damaging 1.00
R2857:Phrf1 UTSW 7 140,839,593 (GRCm39) unclassified probably benign
R3796:Phrf1 UTSW 7 140,839,831 (GRCm39) nonsense probably null
R3797:Phrf1 UTSW 7 140,839,831 (GRCm39) nonsense probably null
R3798:Phrf1 UTSW 7 140,839,831 (GRCm39) nonsense probably null
R3799:Phrf1 UTSW 7 140,839,831 (GRCm39) nonsense probably null
R4080:Phrf1 UTSW 7 140,839,633 (GRCm39) unclassified probably benign
R4081:Phrf1 UTSW 7 140,838,970 (GRCm39) unclassified probably benign
R4557:Phrf1 UTSW 7 140,838,842 (GRCm39) unclassified probably benign
R5217:Phrf1 UTSW 7 140,840,616 (GRCm39) missense probably damaging 1.00
R5218:Phrf1 UTSW 7 140,841,214 (GRCm39) missense possibly damaging 0.94
R5442:Phrf1 UTSW 7 140,820,850 (GRCm39) missense probably damaging 1.00
R5501:Phrf1 UTSW 7 140,839,834 (GRCm39) missense possibly damaging 0.91
R5695:Phrf1 UTSW 7 140,838,378 (GRCm39) unclassified probably benign
R5837:Phrf1 UTSW 7 140,839,974 (GRCm39) missense probably benign 0.34
R5907:Phrf1 UTSW 7 140,840,453 (GRCm39) missense possibly damaging 0.79
R5996:Phrf1 UTSW 7 140,839,015 (GRCm39) unclassified probably benign
R6024:Phrf1 UTSW 7 140,838,898 (GRCm39) unclassified probably benign
R6244:Phrf1 UTSW 7 140,817,586 (GRCm39) missense probably damaging 1.00
R6512:Phrf1 UTSW 7 140,840,309 (GRCm39) missense possibly damaging 0.88
R7016:Phrf1 UTSW 7 140,817,476 (GRCm39) missense probably damaging 0.98
R7311:Phrf1 UTSW 7 140,820,846 (GRCm39) missense unknown
R7409:Phrf1 UTSW 7 140,839,205 (GRCm39) missense unknown
R7517:Phrf1 UTSW 7 140,836,523 (GRCm39) missense unknown
R7560:Phrf1 UTSW 7 140,811,138 (GRCm39) critical splice acceptor site probably null
R7699:Phrf1 UTSW 7 140,834,842 (GRCm39) missense unknown
R7700:Phrf1 UTSW 7 140,834,842 (GRCm39) missense unknown
R7867:Phrf1 UTSW 7 140,836,524 (GRCm39) missense unknown
R7895:Phrf1 UTSW 7 140,839,288 (GRCm39) missense unknown
R8179:Phrf1 UTSW 7 140,836,493 (GRCm39) missense unknown
R8705:Phrf1 UTSW 7 140,838,651 (GRCm39) missense unknown
R8708:Phrf1 UTSW 7 140,812,446 (GRCm39) missense unknown
R8748:Phrf1 UTSW 7 140,838,148 (GRCm39) missense unknown
R8768:Phrf1 UTSW 7 140,838,651 (GRCm39) missense unknown
R8789:Phrf1 UTSW 7 140,836,581 (GRCm39) missense unknown
R8859:Phrf1 UTSW 7 140,836,516 (GRCm39) missense unknown
R8991:Phrf1 UTSW 7 140,823,671 (GRCm39) missense unknown
R9086:Phrf1 UTSW 7 140,839,412 (GRCm39) missense unknown
R9158:Phrf1 UTSW 7 140,836,466 (GRCm39) missense unknown
R9287:Phrf1 UTSW 7 140,840,055 (GRCm39) missense probably benign 0.35
R9561:Phrf1 UTSW 7 140,834,815 (GRCm39) missense unknown
X0027:Phrf1 UTSW 7 140,836,481 (GRCm39) missense probably benign
Z1176:Phrf1 UTSW 7 140,838,731 (GRCm39) missense unknown
Z1176:Phrf1 UTSW 7 140,823,796 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CTAGTGAGCCTGTATCTGGC -3'
(R):5'- TACTGAGCGTGAAGTCCTGTC -3'

Sequencing Primer
(F):5'- CATGCTGGAGTTACTCAGCAAG -3'
(R):5'- TGAAGTCCTGTCCCTGGAG -3'
Posted On 2016-07-22