Incidental Mutation 'R5276:Phrf1'
ID403947
Institutional Source Beutler Lab
Gene Symbol Phrf1
Ensembl Gene ENSMUSG00000038611
Gene NamePHD and ring finger domains 1
Synonyms
MMRRC Submission 042863-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5276 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141228784-141262750 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 141259283 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026571] [ENSMUST00000097952] [ENSMUST00000106023] [ENSMUST00000106027] [ENSMUST00000122143] [ENSMUST00000132540] [ENSMUST00000209899] [ENSMUST00000155123]
Predicted Effect probably benign
Transcript: ENSMUST00000026571
SMART Domains Protein: ENSMUSP00000026571
Gene: ENSMUSG00000025498

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 240 420 1.38e-63 SMART
low complexity region 425 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097952
SMART Domains Protein: ENSMUSP00000095565
Gene: ENSMUSG00000025498

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 209 389 1.38e-63 SMART
low complexity region 394 411 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106023
SMART Domains Protein: ENSMUSP00000101644
Gene: ENSMUSG00000025498

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 208 388 1.38e-63 SMART
low complexity region 393 410 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000106027
AA Change: V956A
SMART Domains Protein: ENSMUSP00000101648
Gene: ENSMUSG00000038611
AA Change: V956A

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
C1 173 229 7.05e-2 SMART
PHD 187 233 1.77e-14 SMART
RING 188 232 3.17e0 SMART
low complexity region 332 369 N/A INTRINSIC
low complexity region 491 505 N/A INTRINSIC
low complexity region 507 522 N/A INTRINSIC
low complexity region 717 728 N/A INTRINSIC
low complexity region 831 857 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 944 955 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 999 1020 N/A INTRINSIC
low complexity region 1027 1043 N/A INTRINSIC
low complexity region 1051 1090 N/A INTRINSIC
low complexity region 1094 1151 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1217 1241 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
low complexity region 1288 1306 N/A INTRINSIC
low complexity region 1308 1319 N/A INTRINSIC
low complexity region 1359 1376 N/A INTRINSIC
low complexity region 1426 1441 N/A INTRINSIC
low complexity region 1575 1592 N/A INTRINSIC
Blast:IG_like 1593 1636 4e-14 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000122143
AA Change: V797A
SMART Domains Protein: ENSMUSP00000113195
Gene: ENSMUSG00000038611
AA Change: V797A

DomainStartEndE-ValueType
C1 14 70 7.05e-2 SMART
PHD 28 74 1.77e-14 SMART
low complexity region 173 210 N/A INTRINSIC
low complexity region 332 346 N/A INTRINSIC
low complexity region 348 363 N/A INTRINSIC
low complexity region 558 569 N/A INTRINSIC
low complexity region 672 698 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 840 861 N/A INTRINSIC
low complexity region 868 884 N/A INTRINSIC
low complexity region 892 931 N/A INTRINSIC
low complexity region 935 992 N/A INTRINSIC
low complexity region 1001 1014 N/A INTRINSIC
low complexity region 1058 1082 N/A INTRINSIC
low complexity region 1086 1102 N/A INTRINSIC
low complexity region 1129 1147 N/A INTRINSIC
low complexity region 1149 1160 N/A INTRINSIC
low complexity region 1200 1217 N/A INTRINSIC
low complexity region 1267 1282 N/A INTRINSIC
low complexity region 1416 1433 N/A INTRINSIC
Blast:IG_like 1434 1477 4e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122868
Predicted Effect probably benign
Transcript: ENSMUST00000123525
SMART Domains Protein: ENSMUSP00000121026
Gene: ENSMUSG00000025498

DomainStartEndE-ValueType
IRF 1 69 6.35e-3 SMART
IRF-3 77 251 2.62e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127223
Predicted Effect probably benign
Transcript: ENSMUST00000130687
SMART Domains Protein: ENSMUSP00000123351
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 100 115 N/A INTRINSIC
low complexity region 224 241 N/A INTRINSIC
Blast:IG_like 242 285 5e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131399
Predicted Effect probably benign
Transcript: ENSMUST00000132540
Predicted Effect unknown
Transcript: ENSMUST00000142572
AA Change: V31A
SMART Domains Protein: ENSMUSP00000117393
Gene: ENSMUSG00000038611
AA Change: V31A

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 41 52 N/A INTRINSIC
low complexity region 75 96 N/A INTRINSIC
low complexity region 103 119 N/A INTRINSIC
low complexity region 127 166 N/A INTRINSIC
low complexity region 170 227 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 293 317 N/A INTRINSIC
low complexity region 321 337 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 384 395 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
low complexity region 666 683 N/A INTRINSIC
Blast:IG_like 684 727 3e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155744
Predicted Effect probably benign
Transcript: ENSMUST00000209899
Predicted Effect probably benign
Transcript: ENSMUST00000155123
SMART Domains Protein: ENSMUSP00000120759
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
Blast:C1 165 209 2e-17 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A G 8: 43,570,420 F11S probably benign Het
Adipor2 T A 6: 119,357,221 I343F probably damaging Het
Ahdc1 C T 4: 133,062,798 P450L possibly damaging Het
Akna A C 4: 63,368,203 V1353G possibly damaging Het
Baz2b G A 2: 59,962,614 T390I probably benign Het
Btbd7 T C 12: 102,838,392 K130E probably benign Het
Cdc42bpa A G 1: 180,137,850 Y1101C probably damaging Het
Crlf2 T G 5: 109,557,635 probably benign Het
Ddx59 A T 1: 136,419,448 R281S probably damaging Het
Dgcr8 T G 16: 18,283,771 T216P probably benign Het
Dsg4 A T 18: 20,446,839 I34F probably benign Het
Enpp3 A G 10: 24,809,916 S194P probably damaging Het
Entpd8 C T 2: 25,085,045 R463W probably benign Het
Fam169a A G 13: 97,118,496 T407A probably benign Het
Fam98b G T 2: 117,259,298 V99F possibly damaging Het
Foxn3 T A 12: 99,196,428 K405* probably null Het
Gm340 T A 19: 41,585,039 H744Q probably damaging Het
Gsdmc T C 15: 63,801,957 T160A probably benign Het
Hdac1 T C 4: 129,528,923 probably null Het
Igfbp1 A C 11: 7,201,892 T232P probably damaging Het
Mertk G C 2: 128,801,314 G878R possibly damaging Het
Metap2 G T 10: 93,868,922 P281H possibly damaging Het
Metap2 T A 10: 93,868,932 T278S probably benign Het
Mfn1 T C 3: 32,564,205 V169A probably benign Het
Mms22l A G 4: 24,578,774 D751G probably damaging Het
Mpl A G 4: 118,455,721 V138A probably benign Het
Myef2 T A 2: 125,095,721 K533N probably damaging Het
Mylk3 C T 8: 85,355,442 G309E probably damaging Het
Nid1 T C 13: 13,468,572 V365A probably damaging Het
Olfr27 T C 9: 39,144,315 C72R probably damaging Het
Olfr463 A T 11: 87,893,192 I244N probably damaging Het
Olfr480 A T 7: 108,066,216 L164* probably null Het
Olfr77 C A 9: 19,920,621 N137K possibly damaging Het
Pbrm1 A G 14: 31,106,184 K1323E probably damaging Het
Pcdhga12 G A 18: 37,766,675 D187N possibly damaging Het
Phtf2 A G 5: 20,772,197 V608A probably benign Het
Plec G A 15: 76,173,438 R4122W probably damaging Het
Polm A G 11: 5,829,393 S441P probably benign Het
Prrc2b T A 2: 32,214,722 V1404E probably benign Het
Ptger1 T G 8: 83,669,345 S344A possibly damaging Het
Rasef A T 4: 73,735,767 D401E probably null Het
Rbfox3 T C 11: 118,496,352 Y312C probably damaging Het
Rbm48 A G 5: 3,584,759 C402R probably benign Het
Rhbdl3 G A 11: 80,319,666 A82T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sidt2 T A 9: 45,954,777 N44Y probably damaging Het
Slf2 T A 19: 44,935,161 L138Q possibly damaging Het
Spag16 T C 1: 69,896,583 probably null Het
Sspo C T 6: 48,490,467 P4188S probably damaging Het
Synm C T 7: 67,734,689 S1075N probably benign Het
Tacc2 G T 7: 130,729,317 D2151Y probably damaging Het
Tbc1d32 C A 10: 56,151,818 L729F probably damaging Het
Tnfsf4 A G 1: 161,417,013 N91S possibly damaging Het
Trim63 G A 4: 134,323,133 E243K probably benign Het
Trim72 T G 7: 128,004,542 L20R probably damaging Het
Tubb1 A G 2: 174,457,424 M300V probably damaging Het
Ubfd1 C T 7: 122,068,868 A207V probably damaging Het
Usp16 T A 16: 87,470,451 probably null Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Vmn2r72 T A 7: 85,738,254 I701F possibly damaging Het
Wdfy4 A G 14: 33,047,275 Y2078H probably damaging Het
Wdr41 T C 13: 95,017,450 probably null Het
Zfp955b A G 17: 33,303,057 Y500C probably damaging Het
Other mutations in Phrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Phrf1 APN 7 141258877 unclassified probably benign
IGL01391:Phrf1 APN 7 141262481 missense probably damaging 1.00
IGL01472:Phrf1 APN 7 141256490 splice site probably benign
IGL01633:Phrf1 APN 7 141260500 missense probably benign 0.43
IGL01808:Phrf1 APN 7 141260966 missense probably damaging 1.00
IGL02004:Phrf1 APN 7 141260333 missense probably benign 0.39
IGL02138:Phrf1 APN 7 141259283 unclassified probably benign
IGL02678:Phrf1 APN 7 141260282 missense probably damaging 1.00
IGL03077:Phrf1 APN 7 141254968 nonsense probably null
PIT4466001:Phrf1 UTSW 7 141258812 missense unknown
R0036:Phrf1 UTSW 7 141261780 missense probably damaging 1.00
R0036:Phrf1 UTSW 7 141261780 missense probably damaging 1.00
R0040:Phrf1 UTSW 7 141243857 missense probably damaging 1.00
R0358:Phrf1 UTSW 7 141258304 unclassified probably benign
R0445:Phrf1 UTSW 7 141247331 utr 3 prime probably benign
R0535:Phrf1 UTSW 7 141260065 missense probably benign 0.07
R0561:Phrf1 UTSW 7 141254963 missense probably benign 0.00
R0940:Phrf1 UTSW 7 141254855 splice site probably benign
R1499:Phrf1 UTSW 7 141256651 missense probably damaging 1.00
R1511:Phrf1 UTSW 7 141259801 unclassified probably benign
R1651:Phrf1 UTSW 7 141237521 missense probably benign
R1691:Phrf1 UTSW 7 141261874 nonsense probably null
R1778:Phrf1 UTSW 7 141232456 missense probably benign 0.01
R1851:Phrf1 UTSW 7 141240918 missense probably damaging 1.00
R2239:Phrf1 UTSW 7 141237692 missense probably damaging 1.00
R2857:Phrf1 UTSW 7 141259680 unclassified probably benign
R3796:Phrf1 UTSW 7 141259918 nonsense probably null
R3797:Phrf1 UTSW 7 141259918 nonsense probably null
R3798:Phrf1 UTSW 7 141259918 nonsense probably null
R3799:Phrf1 UTSW 7 141259918 nonsense probably null
R4080:Phrf1 UTSW 7 141259720 unclassified probably benign
R4081:Phrf1 UTSW 7 141259057 unclassified probably benign
R4557:Phrf1 UTSW 7 141258929 unclassified probably benign
R5217:Phrf1 UTSW 7 141260703 missense probably damaging 1.00
R5218:Phrf1 UTSW 7 141261301 missense possibly damaging 0.94
R5442:Phrf1 UTSW 7 141240937 missense probably damaging 1.00
R5501:Phrf1 UTSW 7 141259921 missense possibly damaging 0.91
R5695:Phrf1 UTSW 7 141258465 unclassified probably benign
R5837:Phrf1 UTSW 7 141260061 missense probably benign 0.34
R5907:Phrf1 UTSW 7 141260540 missense possibly damaging 0.79
R5996:Phrf1 UTSW 7 141259102 unclassified probably benign
R6024:Phrf1 UTSW 7 141258985 unclassified probably benign
R6244:Phrf1 UTSW 7 141237673 missense probably damaging 1.00
R6512:Phrf1 UTSW 7 141260396 missense possibly damaging 0.88
R7016:Phrf1 UTSW 7 141237563 missense probably damaging 0.98
R7311:Phrf1 UTSW 7 141240933 missense unknown
R7409:Phrf1 UTSW 7 141259292 missense unknown
R7517:Phrf1 UTSW 7 141256610 missense unknown
R7560:Phrf1 UTSW 7 141231225 critical splice acceptor site probably null
R7699:Phrf1 UTSW 7 141254929 missense unknown
R7700:Phrf1 UTSW 7 141254929 missense unknown
R7867:Phrf1 UTSW 7 141256611 missense unknown
R7895:Phrf1 UTSW 7 141259375 missense unknown
R8179:Phrf1 UTSW 7 141256580 missense unknown
R8705:Phrf1 UTSW 7 141258738 missense unknown
R8708:Phrf1 UTSW 7 141232533 missense unknown
R8748:Phrf1 UTSW 7 141258235 missense unknown
R8768:Phrf1 UTSW 7 141258738 missense unknown
R8789:Phrf1 UTSW 7 141256668 missense unknown
R8859:Phrf1 UTSW 7 141256603 missense unknown
X0027:Phrf1 UTSW 7 141256568 missense probably benign
Z1176:Phrf1 UTSW 7 141243883 missense unknown
Z1176:Phrf1 UTSW 7 141258818 missense unknown
Predicted Primers PCR Primer
(F):5'- CTAGTGAGCCTGTATCTGGC -3'
(R):5'- TACTGAGCGTGAAGTCCTGTC -3'

Sequencing Primer
(F):5'- CATGCTGGAGTTACTCAGCAAG -3'
(R):5'- TGAAGTCCTGTCCCTGGAG -3'
Posted On2016-07-22