Incidental Mutation 'R0417:Osbpl3'
ID 40395
Institutional Source Beutler Lab
Gene Symbol Osbpl3
Ensembl Gene ENSMUSG00000029822
Gene Name oxysterol binding protein-like 3
Synonyms ORP3, 1200014M06Rik, 6720421I08Rik, OSBP3
MMRRC Submission 038619-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0417 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 50270310-50433181 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 50324998 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 167 (V167I)
Ref Sequence ENSEMBL: ENSMUSP00000110112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071728] [ENSMUST00000090019] [ENSMUST00000114466] [ENSMUST00000114468] [ENSMUST00000136926] [ENSMUST00000203907] [ENSMUST00000146341]
AlphaFold Q9DBS9
Predicted Effect probably benign
Transcript: ENSMUST00000071728
AA Change: V167I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071643
Gene: ENSMUSG00000029822
AA Change: V167I

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 254 311 4e-25 BLAST
low complexity region 392 425 N/A INTRINSIC
Pfam:Oxysterol_BP 459 804 3.2e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090019
AA Change: V167I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087473
Gene: ENSMUSG00000029822
AA Change: V167I

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 288 342 4e-25 BLAST
low complexity region 459 492 N/A INTRINSIC
Pfam:Oxysterol_BP 526 870 3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114466
AA Change: V167I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110110
Gene: ENSMUSG00000029822
AA Change: V167I

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 288 342 3e-25 BLAST
low complexity region 423 456 N/A INTRINSIC
Pfam:Oxysterol_BP 490 835 3.5e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114468
AA Change: V167I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110112
Gene: ENSMUSG00000029822
AA Change: V167I

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 254 311 4e-25 BLAST
low complexity region 428 461 N/A INTRINSIC
Pfam:Oxysterol_BP 495 840 1.3e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133141
Predicted Effect probably benign
Transcript: ENSMUST00000136926
SMART Domains Protein: ENSMUSP00000144934
Gene: ENSMUSG00000029822

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
SCOP:d1btka_ 50 75 5e-4 SMART
Blast:PH 51 76 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000203907
SMART Domains Protein: ENSMUSP00000145249
Gene: ENSMUSG00000029822

DomainStartEndE-ValueType
Blast:PH 1 91 1e-57 BLAST
low complexity region 208 241 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146341
SMART Domains Protein: ENSMUSP00000114472
Gene: ENSMUSG00000029822

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 144 1.27e-6 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. The encoded protein is involved in the regulation of cell adhesion and organization of the actin cytoskeleton. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 73,199,244 (GRCm39) K217R probably damaging Het
1810024B03Rik A G 2: 127,028,864 (GRCm39) Y112H probably damaging Het
Acot2 T C 12: 84,037,387 (GRCm39) Y234H probably benign Het
Alox12e C T 11: 70,212,691 (GRCm39) V53I probably benign Het
Ankrd50 T C 3: 38,510,510 (GRCm39) H619R probably damaging Het
Arfgef3 A T 10: 18,479,259 (GRCm39) L1452Q probably damaging Het
Arhgap42 T C 9: 9,180,034 (GRCm39) S82G possibly damaging Het
Arhgef18 T C 8: 3,438,957 (GRCm39) probably benign Het
Bicra C A 7: 15,706,247 (GRCm39) R1398L probably damaging Het
Boc T C 16: 44,340,597 (GRCm39) T118A probably benign Het
Btnl9 A G 11: 49,066,422 (GRCm39) Y381H probably damaging Het
Cbln3 T G 14: 56,121,586 (GRCm39) E20A probably benign Het
Cdc42ep5 A G 7: 4,154,482 (GRCm39) L102P probably damaging Het
Csrnp3 A G 2: 65,849,887 (GRCm39) Y171C probably benign Het
Cyp2d9 A T 15: 82,340,152 (GRCm39) I181F probably damaging Het
Cyp7b1 T A 3: 18,150,855 (GRCm39) T295S probably damaging Het
Dbn1 C T 13: 55,622,729 (GRCm39) E585K probably damaging Het
Dok1 A T 6: 83,008,550 (GRCm39) D377E probably damaging Het
Eed A T 7: 89,620,760 (GRCm39) Y87* probably null Het
Entpd3 T C 9: 120,386,487 (GRCm39) V156A probably damaging Het
Exo5 T A 4: 120,779,269 (GRCm39) T199S probably damaging Het
Extl2 T C 3: 115,818,006 (GRCm39) I106T probably benign Het
Ezh2 A G 6: 47,528,660 (GRCm39) C291R probably benign Het
Flvcr1 A T 1: 190,743,416 (GRCm39) M466K probably benign Het
Fras1 G T 5: 96,839,231 (GRCm39) M1583I probably benign Het
Fzd9 G T 5: 135,278,473 (GRCm39) R471S probably damaging Het
Galr1 A T 18: 82,423,665 (GRCm39) F204Y probably damaging Het
Gna11 A T 10: 81,366,738 (GRCm39) I324N probably damaging Het
Gucy1a2 A G 9: 3,759,484 (GRCm39) E430G possibly damaging Het
Hhatl C T 9: 121,617,828 (GRCm39) A254T probably benign Het
Ikzf1 A C 11: 11,719,352 (GRCm39) N353T probably benign Het
Il7 T A 3: 7,641,087 (GRCm39) T110S probably damaging Het
Keg1 A G 19: 12,688,424 (GRCm39) N53D probably damaging Het
Klhl21 T C 4: 152,099,964 (GRCm39) I558T probably damaging Het
Lca5l G A 16: 95,963,853 (GRCm39) T357M probably damaging Het
Lrba T C 3: 86,622,961 (GRCm39) S2448P probably damaging Het
Map3k6 T A 4: 132,975,393 (GRCm39) Y709* probably null Het
Megf6 A G 4: 154,352,424 (GRCm39) E1261G probably benign Het
Mettl3 C T 14: 52,534,155 (GRCm39) G473D probably damaging Het
Mga A G 2: 119,733,271 (GRCm39) I40V probably damaging Het
Mmp13 T A 9: 7,276,602 (GRCm39) D232E probably benign Het
Nampt T C 12: 32,883,100 (GRCm39) V95A probably benign Het
Nbeal1 T C 1: 60,286,893 (GRCm39) V905A probably benign Het
Nomo1 A T 7: 45,718,122 (GRCm39) E840V possibly damaging Het
Nprl2 A T 9: 107,420,497 (GRCm39) I101F probably damaging Het
Nup160 A T 2: 90,565,771 (GRCm39) I1378F possibly damaging Het
Ogdhl T C 14: 32,048,936 (GRCm39) S69P probably damaging Het
Or2y17 T A 11: 49,231,500 (GRCm39) I47N possibly damaging Het
Or4a68 C A 2: 89,270,519 (GRCm39) V35L possibly damaging Het
Or4k77 A G 2: 111,199,450 (GRCm39) S158G possibly damaging Het
Or5be3 A T 2: 86,863,789 (GRCm39) Y259N probably damaging Het
Or8b12i G A 9: 20,082,510 (GRCm39) A119V probably damaging Het
Or8c16 A G 9: 38,130,751 (GRCm39) I211V probably benign Het
Or8c8 T C 9: 38,165,160 (GRCm39) F149S probably benign Het
Pclo T A 5: 14,763,036 (GRCm39) H3836Q unknown Het
Prkcg A T 7: 3,352,820 (GRCm39) probably null Het
Ror1 A T 4: 100,269,197 (GRCm39) H345L possibly damaging Het
Slc36a2 C T 11: 55,072,370 (GRCm39) probably null Het
Slc40a1 G A 1: 45,950,534 (GRCm39) P306L possibly damaging Het
Slc9a8 C A 2: 167,299,264 (GRCm39) T239K probably benign Het
Snapc3 A G 4: 83,368,399 (GRCm39) I299V probably benign Het
Sp3 G A 2: 72,801,845 (GRCm39) A56V possibly damaging Het
Spag17 T A 3: 99,972,870 (GRCm39) S1361T probably benign Het
Sptbn2 A G 19: 4,787,954 (GRCm39) T978A probably benign Het
Stom C A 2: 35,211,644 (GRCm39) V126F probably damaging Het
Stpg2 A G 3: 138,924,082 (GRCm39) T162A probably damaging Het
Stxbp6 G A 12: 44,949,740 (GRCm39) T63M probably damaging Het
Tatdn1 A C 15: 58,793,199 (GRCm39) I69S probably benign Het
Tbata A T 10: 61,016,118 (GRCm39) D198V probably damaging Het
Tbc1d5 T C 17: 51,063,733 (GRCm39) I638V probably benign Het
Tomm70a A G 16: 56,970,266 (GRCm39) D548G probably benign Het
Ust A G 10: 8,121,700 (GRCm39) F303L probably damaging Het
Vps13d A G 4: 144,703,130 (GRCm39) S4306P probably benign Het
Zbed6 A T 1: 133,586,276 (GRCm39) S354T probably benign Het
Zfp691 A G 4: 119,027,693 (GRCm39) S180P possibly damaging Het
Other mutations in Osbpl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Osbpl3 APN 6 50,300,048 (GRCm39) missense probably damaging 1.00
IGL01784:Osbpl3 APN 6 50,321,902 (GRCm39) missense probably damaging 1.00
IGL02221:Osbpl3 APN 6 50,304,347 (GRCm39) unclassified probably benign
IGL02323:Osbpl3 APN 6 50,323,306 (GRCm39) critical splice donor site probably null
IGL02894:Osbpl3 APN 6 50,323,312 (GRCm39) missense possibly damaging 0.89
H8562:Osbpl3 UTSW 6 50,324,446 (GRCm39) missense probably benign 0.09
PIT4283001:Osbpl3 UTSW 6 50,323,068 (GRCm39) missense probably benign 0.01
R0226:Osbpl3 UTSW 6 50,329,988 (GRCm39) missense probably damaging 1.00
R0416:Osbpl3 UTSW 6 50,324,998 (GRCm39) missense probably benign
R0601:Osbpl3 UTSW 6 50,276,383 (GRCm39) missense probably benign 0.05
R0826:Osbpl3 UTSW 6 50,323,357 (GRCm39) missense probably damaging 1.00
R1390:Osbpl3 UTSW 6 50,285,407 (GRCm39) missense probably damaging 1.00
R1520:Osbpl3 UTSW 6 50,323,411 (GRCm39) missense possibly damaging 0.75
R1603:Osbpl3 UTSW 6 50,300,073 (GRCm39) missense probably damaging 1.00
R1678:Osbpl3 UTSW 6 50,313,193 (GRCm39) critical splice donor site probably null
R1843:Osbpl3 UTSW 6 50,347,123 (GRCm39) missense probably damaging 1.00
R1943:Osbpl3 UTSW 6 50,297,054 (GRCm39) missense probably benign 0.16
R3435:Osbpl3 UTSW 6 50,325,050 (GRCm39) missense possibly damaging 0.94
R3768:Osbpl3 UTSW 6 50,324,982 (GRCm39) missense possibly damaging 0.64
R4746:Osbpl3 UTSW 6 50,305,654 (GRCm39) missense probably damaging 0.99
R4751:Osbpl3 UTSW 6 50,277,977 (GRCm39) missense possibly damaging 0.95
R4776:Osbpl3 UTSW 6 50,277,953 (GRCm39) missense probably benign 0.01
R4814:Osbpl3 UTSW 6 50,329,980 (GRCm39) missense probably damaging 1.00
R4841:Osbpl3 UTSW 6 50,286,356 (GRCm39) missense probably damaging 1.00
R4881:Osbpl3 UTSW 6 50,329,764 (GRCm39) missense possibly damaging 0.95
R4999:Osbpl3 UTSW 6 50,313,277 (GRCm39) missense probably damaging 0.99
R5512:Osbpl3 UTSW 6 50,286,340 (GRCm39) missense probably damaging 0.98
R6282:Osbpl3 UTSW 6 50,325,063 (GRCm39) splice site probably null
R6304:Osbpl3 UTSW 6 50,289,654 (GRCm39) missense probably damaging 1.00
R6905:Osbpl3 UTSW 6 50,328,862 (GRCm39) missense probably damaging 1.00
R7000:Osbpl3 UTSW 6 50,274,137 (GRCm39) missense probably damaging 1.00
R7102:Osbpl3 UTSW 6 50,297,115 (GRCm39) missense probably damaging 1.00
R7275:Osbpl3 UTSW 6 50,323,410 (GRCm39) missense probably benign 0.02
R7334:Osbpl3 UTSW 6 50,321,886 (GRCm39) missense possibly damaging 0.78
R7368:Osbpl3 UTSW 6 50,325,078 (GRCm39) missense probably damaging 1.00
R8052:Osbpl3 UTSW 6 50,322,995 (GRCm39) missense probably damaging 1.00
R8183:Osbpl3 UTSW 6 50,280,089 (GRCm39) missense probably benign 0.00
R8810:Osbpl3 UTSW 6 50,328,852 (GRCm39) missense probably damaging 1.00
R8932:Osbpl3 UTSW 6 50,304,371 (GRCm39) missense probably benign 0.37
R9168:Osbpl3 UTSW 6 50,329,762 (GRCm39) critical splice donor site probably null
R9447:Osbpl3 UTSW 6 50,321,857 (GRCm39) nonsense probably null
R9476:Osbpl3 UTSW 6 50,313,194 (GRCm39) critical splice donor site probably null
R9510:Osbpl3 UTSW 6 50,313,194 (GRCm39) critical splice donor site probably null
R9788:Osbpl3 UTSW 6 50,324,344 (GRCm39) critical splice donor site probably null
RF011:Osbpl3 UTSW 6 50,325,118 (GRCm39) critical splice acceptor site probably benign
Z1088:Osbpl3 UTSW 6 50,274,077 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTACGCAGGCTTAGCTGCATC -3'
(R):5'- TCTTTGAGTGTCCTCCGAGACCAC -3'

Sequencing Primer
(F):5'- TTAGCTGCATCCGACAGG -3'
(R):5'- ATGAATAACTGATCCCGTCTTAGCC -3'
Posted On 2013-05-23