Incidental Mutation 'R5276:Olfr27'
ID403952
Institutional Source Beutler Lab
Gene Symbol Olfr27
Ensembl Gene ENSMUSG00000049708
Gene Nameolfactory receptor 27
SynonymsMOR171-6, GA_x6K02T2PVTD-32841223-32842158, MTPCR56
MMRRC Submission 042863-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5276 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39128131-39145072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39144315 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 72 (C72R)
Ref Sequence ENSEMBL: ENSMUSP00000150009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214052] [ENSMUST00000216405]
Predicted Effect probably damaging
Transcript: ENSMUST00000057811
AA Change: C72R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110642
Gene: ENSMUSG00000049708
AA Change: C72R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-49 PFAM
Pfam:7tm_1 41 290 2.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214052
AA Change: C72R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216405
AA Change: C72R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A G 8: 43,570,420 F11S probably benign Het
Adipor2 T A 6: 119,357,221 I343F probably damaging Het
Ahdc1 C T 4: 133,062,798 P450L possibly damaging Het
Akna A C 4: 63,368,203 V1353G possibly damaging Het
Baz2b G A 2: 59,962,614 T390I probably benign Het
Btbd7 T C 12: 102,838,392 K130E probably benign Het
Cdc42bpa A G 1: 180,137,850 Y1101C probably damaging Het
Crlf2 T G 5: 109,557,635 probably benign Het
Ddx59 A T 1: 136,419,448 R281S probably damaging Het
Dgcr8 T G 16: 18,283,771 T216P probably benign Het
Dsg4 A T 18: 20,446,839 I34F probably benign Het
Enpp3 A G 10: 24,809,916 S194P probably damaging Het
Entpd8 C T 2: 25,085,045 R463W probably benign Het
Fam169a A G 13: 97,118,496 T407A probably benign Het
Fam98b G T 2: 117,259,298 V99F possibly damaging Het
Foxn3 T A 12: 99,196,428 K405* probably null Het
Gm340 T A 19: 41,585,039 H744Q probably damaging Het
Gsdmc T C 15: 63,801,957 T160A probably benign Het
Hdac1 T C 4: 129,528,923 probably null Het
Igfbp1 A C 11: 7,201,892 T232P probably damaging Het
Mertk G C 2: 128,801,314 G878R possibly damaging Het
Metap2 G T 10: 93,868,922 P281H possibly damaging Het
Metap2 T A 10: 93,868,932 T278S probably benign Het
Mfn1 T C 3: 32,564,205 V169A probably benign Het
Mms22l A G 4: 24,578,774 D751G probably damaging Het
Mpl A G 4: 118,455,721 V138A probably benign Het
Myef2 T A 2: 125,095,721 K533N probably damaging Het
Mylk3 C T 8: 85,355,442 G309E probably damaging Het
Nid1 T C 13: 13,468,572 V365A probably damaging Het
Olfr463 A T 11: 87,893,192 I244N probably damaging Het
Olfr480 A T 7: 108,066,216 L164* probably null Het
Olfr77 C A 9: 19,920,621 N137K possibly damaging Het
Pbrm1 A G 14: 31,106,184 K1323E probably damaging Het
Pcdhga12 G A 18: 37,766,675 D187N possibly damaging Het
Phrf1 T C 7: 141,259,283 probably benign Het
Phtf2 A G 5: 20,772,197 V608A probably benign Het
Plec G A 15: 76,173,438 R4122W probably damaging Het
Polm A G 11: 5,829,393 S441P probably benign Het
Prrc2b T A 2: 32,214,722 V1404E probably benign Het
Ptger1 T G 8: 83,669,345 S344A possibly damaging Het
Rasef A T 4: 73,735,767 D401E probably null Het
Rbfox3 T C 11: 118,496,352 Y312C probably damaging Het
Rbm48 A G 5: 3,584,759 C402R probably benign Het
Rhbdl3 G A 11: 80,319,666 A82T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sidt2 T A 9: 45,954,777 N44Y probably damaging Het
Slf2 T A 19: 44,935,161 L138Q possibly damaging Het
Spag16 T C 1: 69,896,583 probably null Het
Sspo C T 6: 48,490,467 P4188S probably damaging Het
Synm C T 7: 67,734,689 S1075N probably benign Het
Tacc2 G T 7: 130,729,317 D2151Y probably damaging Het
Tbc1d32 C A 10: 56,151,818 L729F probably damaging Het
Tnfsf4 A G 1: 161,417,013 N91S possibly damaging Het
Trim63 G A 4: 134,323,133 E243K probably benign Het
Trim72 T G 7: 128,004,542 L20R probably damaging Het
Tubb1 A G 2: 174,457,424 M300V probably damaging Het
Ubfd1 C T 7: 122,068,868 A207V probably damaging Het
Usp16 T A 16: 87,470,451 probably null Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Vmn2r72 T A 7: 85,738,254 I701F possibly damaging Het
Wdfy4 A G 14: 33,047,275 Y2078H probably damaging Het
Wdr41 T C 13: 95,017,450 probably null Het
Zfp955b A G 17: 33,303,057 Y500C probably damaging Het
Other mutations in Olfr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr27 APN 9 39144757 missense possibly damaging 0.94
IGL00905:Olfr27 APN 9 39145030 missense probably damaging 1.00
IGL02346:Olfr27 APN 9 39144643 missense probably damaging 1.00
R0117:Olfr27 UTSW 9 39144850 missense probably damaging 1.00
R0118:Olfr27 UTSW 9 39144103 start codon destroyed probably null 0.97
R0590:Olfr27 UTSW 9 39144721 missense probably benign 0.01
R2915:Olfr27 UTSW 9 39144466 missense possibly damaging 0.94
R4299:Olfr27 UTSW 9 39144999 missense probably benign 0.11
R4367:Olfr27 UTSW 9 39144429 missense probably damaging 0.98
R4663:Olfr27 UTSW 9 39144849 missense probably damaging 0.97
R5503:Olfr27 UTSW 9 39144484 missense probably benign 0.02
R5742:Olfr27 UTSW 9 39144678 missense probably benign 0.07
R5986:Olfr27 UTSW 9 39144982 missense probably null 1.00
R6801:Olfr27 UTSW 9 39144210 missense probably benign 0.01
R7247:Olfr27 UTSW 9 39144857 nonsense probably null
R7520:Olfr27 UTSW 9 39144118 missense probably benign
R7787:Olfr27 UTSW 9 39144252 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TTTGATTGGAGGACATGGCAGC -3'
(R):5'- GGGTTACAAATAGCAACATATCGGTC -3'

Sequencing Primer
(F):5'- GCTGCACAGTGACTGAGTTC -3'
(R):5'- GCAACATATCGGTCATATGCCATTG -3'
Posted On2016-07-22