Incidental Mutation 'R5276:Sidt2'
ID403953
Institutional Source Beutler Lab
Gene Symbol Sidt2
Ensembl Gene ENSMUSG00000034908
Gene NameSID1 transmembrane family, member 2
SynonymsCGI-40
MMRRC Submission 042863-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R5276 (G1)
Quality Score194
Status Not validated
Chromosome9
Chromosomal Location45937857-45955258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45954777 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 44 (N44Y)
Ref Sequence ENSEMBL: ENSMUSP00000110220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038488] [ENSMUST00000114573] [ENSMUST00000162072] [ENSMUST00000162379] [ENSMUST00000162529]
Predicted Effect probably damaging
Transcript: ENSMUST00000038488
AA Change: N44Y

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044290
Gene: ENSMUSG00000034908
AA Change: N44Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SID-1_RNA_chan 169 832 8.5e-214 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114573
AA Change: N44Y

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110220
Gene: ENSMUSG00000034908
AA Change: N44Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SID-1_RNA_chan 169 853 9e-290 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160911
Predicted Effect probably benign
Transcript: ENSMUST00000161606
SMART Domains Protein: ENSMUSP00000125660
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
Pfam:SID-1_RNA_chan 1 221 4.7e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162072
AA Change: N44Y

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124750
Gene: ENSMUSG00000034908
AA Change: N44Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SID-1_RNA_chan 169 338 2.3e-34 PFAM
low complexity region 452 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162379
SMART Domains Protein: ENSMUSP00000124503
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
Pfam:SID-1_RNA_chan 1 135 3.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162529
SMART Domains Protein: ENSMUSP00000125060
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
Pfam:SID-1_RNA_chan 1 135 9.2e-20 PFAM
low complexity region 202 213 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216147
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit male-specific decreased body weight and size, impaired glucose tolerance, increased serum glucose, decreased serum insulin and decreased insule granule release from beta cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A G 8: 43,570,420 F11S probably benign Het
Adipor2 T A 6: 119,357,221 I343F probably damaging Het
Ahdc1 C T 4: 133,062,798 P450L possibly damaging Het
Akna A C 4: 63,368,203 V1353G possibly damaging Het
Baz2b G A 2: 59,962,614 T390I probably benign Het
Btbd7 T C 12: 102,838,392 K130E probably benign Het
Cdc42bpa A G 1: 180,137,850 Y1101C probably damaging Het
Crlf2 T G 5: 109,557,635 probably benign Het
Ddx59 A T 1: 136,419,448 R281S probably damaging Het
Dgcr8 T G 16: 18,283,771 T216P probably benign Het
Dsg4 A T 18: 20,446,839 I34F probably benign Het
Enpp3 A G 10: 24,809,916 S194P probably damaging Het
Entpd8 C T 2: 25,085,045 R463W probably benign Het
Fam169a A G 13: 97,118,496 T407A probably benign Het
Fam98b G T 2: 117,259,298 V99F possibly damaging Het
Foxn3 T A 12: 99,196,428 K405* probably null Het
Gm340 T A 19: 41,585,039 H744Q probably damaging Het
Gsdmc T C 15: 63,801,957 T160A probably benign Het
Hdac1 T C 4: 129,528,923 probably null Het
Igfbp1 A C 11: 7,201,892 T232P probably damaging Het
Mertk G C 2: 128,801,314 G878R possibly damaging Het
Metap2 G T 10: 93,868,922 P281H possibly damaging Het
Metap2 T A 10: 93,868,932 T278S probably benign Het
Mfn1 T C 3: 32,564,205 V169A probably benign Het
Mms22l A G 4: 24,578,774 D751G probably damaging Het
Mpl A G 4: 118,455,721 V138A probably benign Het
Myef2 T A 2: 125,095,721 K533N probably damaging Het
Mylk3 C T 8: 85,355,442 G309E probably damaging Het
Nid1 T C 13: 13,468,572 V365A probably damaging Het
Olfr27 T C 9: 39,144,315 C72R probably damaging Het
Olfr463 A T 11: 87,893,192 I244N probably damaging Het
Olfr480 A T 7: 108,066,216 L164* probably null Het
Olfr77 C A 9: 19,920,621 N137K possibly damaging Het
Pbrm1 A G 14: 31,106,184 K1323E probably damaging Het
Pcdhga12 G A 18: 37,766,675 D187N possibly damaging Het
Phrf1 T C 7: 141,259,283 probably benign Het
Phtf2 A G 5: 20,772,197 V608A probably benign Het
Plec G A 15: 76,173,438 R4122W probably damaging Het
Polm A G 11: 5,829,393 S441P probably benign Het
Prrc2b T A 2: 32,214,722 V1404E probably benign Het
Ptger1 T G 8: 83,669,345 S344A possibly damaging Het
Rasef A T 4: 73,735,767 D401E probably null Het
Rbfox3 T C 11: 118,496,352 Y312C probably damaging Het
Rbm48 A G 5: 3,584,759 C402R probably benign Het
Rhbdl3 G A 11: 80,319,666 A82T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Slf2 T A 19: 44,935,161 L138Q possibly damaging Het
Spag16 T C 1: 69,896,583 probably null Het
Sspo C T 6: 48,490,467 P4188S probably damaging Het
Synm C T 7: 67,734,689 S1075N probably benign Het
Tacc2 G T 7: 130,729,317 D2151Y probably damaging Het
Tbc1d32 C A 10: 56,151,818 L729F probably damaging Het
Tnfsf4 A G 1: 161,417,013 N91S possibly damaging Het
Trim63 G A 4: 134,323,133 E243K probably benign Het
Trim72 T G 7: 128,004,542 L20R probably damaging Het
Tubb1 A G 2: 174,457,424 M300V probably damaging Het
Ubfd1 C T 7: 122,068,868 A207V probably damaging Het
Usp16 T A 16: 87,470,451 probably null Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Vmn2r72 T A 7: 85,738,254 I701F possibly damaging Het
Wdfy4 A G 14: 33,047,275 Y2078H probably damaging Het
Wdr41 T C 13: 95,017,450 probably null Het
Zfp955b A G 17: 33,303,057 Y500C probably damaging Het
Other mutations in Sidt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Sidt2 APN 9 45942236 missense possibly damaging 0.84
IGL00586:Sidt2 APN 9 45943052 missense possibly damaging 0.78
IGL00786:Sidt2 APN 9 45949803 missense possibly damaging 0.69
IGL01069:Sidt2 APN 9 45943077 missense possibly damaging 0.73
IGL01160:Sidt2 APN 9 45942726 missense probably damaging 1.00
IGL01474:Sidt2 APN 9 45946982 critical splice donor site probably null
IGL02068:Sidt2 APN 9 45945664 critical splice donor site probably null
IGL02171:Sidt2 APN 9 45952770 missense possibly damaging 0.81
IGL02312:Sidt2 APN 9 45947001 missense probably benign 0.27
IGL02344:Sidt2 APN 9 45945292 missense probably null 1.00
IGL03030:Sidt2 APN 9 45939505 missense probably damaging 1.00
IGL03062:Sidt2 APN 9 45942683 critical splice donor site probably null
R0157:Sidt2 UTSW 9 45939267 missense probably damaging 1.00
R0330:Sidt2 UTSW 9 45954902 missense probably benign 0.09
R0549:Sidt2 UTSW 9 45953119 splice site probably null
R0714:Sidt2 UTSW 9 45947060 splice site probably benign
R1241:Sidt2 UTSW 9 45945704 missense probably damaging 0.97
R1511:Sidt2 UTSW 9 45950089 missense probably damaging 1.00
R1558:Sidt2 UTSW 9 45951800 missense probably damaging 1.00
R1677:Sidt2 UTSW 9 45953219 missense probably benign 0.01
R2152:Sidt2 UTSW 9 45945340 missense probably damaging 1.00
R2153:Sidt2 UTSW 9 45945340 missense probably damaging 1.00
R2154:Sidt2 UTSW 9 45945340 missense probably damaging 1.00
R4210:Sidt2 UTSW 9 45942775 missense probably benign 0.00
R4349:Sidt2 UTSW 9 45945713 missense possibly damaging 0.94
R4855:Sidt2 UTSW 9 45952029 missense probably benign
R5069:Sidt2 UTSW 9 45939461 unclassified probably null
R5175:Sidt2 UTSW 9 45951788 missense probably damaging 1.00
R5544:Sidt2 UTSW 9 45944455 missense probably damaging 1.00
R5805:Sidt2 UTSW 9 45942199 missense probably damaging 0.97
R5927:Sidt2 UTSW 9 45944454 missense probably damaging 1.00
R6954:Sidt2 UTSW 9 45952850 missense probably benign 0.01
R7060:Sidt2 UTSW 9 45953246 missense possibly damaging 0.91
R7117:Sidt2 UTSW 9 45953219 missense probably benign 0.01
R7207:Sidt2 UTSW 9 45945151 missense probably damaging 1.00
R7317:Sidt2 UTSW 9 45943690 nonsense probably null
X0026:Sidt2 UTSW 9 45939299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGGAAACCAGGTCTTG -3'
(R):5'- ATCTGAGGCCGGGGTTAAAG -3'

Sequencing Primer
(F):5'- CAGGTCTTGGCAGGGGGAG -3'
(R):5'- AGATGCTGGAAGCTGCTGC -3'
Posted On2016-07-22