Mutagenetix > Incidental Mutation

Incidental Mutation 'R5276:Rnf123'

403955

Institutional Source

Beutler Lab

Gene Symbol

Rnf123

Ensembl Gene

ENSMUSG00000041528

Gene Name

ring finger protein 123

Synonyms

KPC1

MMRRC Submission

042863-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.170) question?

Stock #

R5276 (G1)

Quality Score

214

Status

Not validated

Chromosome

Chromosomal Location

108051534-108083346 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

AT to ATT at 108064003 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000136953 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000162753] [ENSMUST00000178267]

AlphaFold

Q5XPI3

Predicted Effect

probably null
Transcript: ENSMUST00000047746

SMART Domains

Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159136

Predicted Effect

probably benign
Transcript: ENSMUST00000159306

SMART Domains

Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
coiled coil region	172	192	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000160249

SMART Domains

Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000160649

SMART Domains

Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160841

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161673

Predicted Effect

probably null
Transcript: ENSMUST00000162355

SMART Domains

Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162753

Predicted Effect

probably null
Transcript: ENSMUST00000178267

SMART Domains

Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26a	A	G	8: 43,570,420	F11S	probably benign	Het
Adipor2	T	A	6: 119,357,221	I343F	probably damaging	Het
Ahdc1	C	T	4: 133,062,798	P450L	possibly damaging	Het
Akna	A	C	4: 63,368,203	V1353G	possibly damaging	Het
Baz2b	G	A	2: 59,962,614	T390I	probably benign	Het
Btbd7	T	C	12: 102,838,392	K130E	probably benign	Het
Cdc42bpa	A	G	1: 180,137,850	Y1101C	probably damaging	Het
Crlf2	T	G	5: 109,557,635		probably benign	Het
Ddx59	A	T	1: 136,419,448	R281S	probably damaging	Het
Dgcr8	T	G	16: 18,283,771	T216P	probably benign	Het
Dsg4	A	T	18: 20,446,839	I34F	probably benign	Het
Enpp3	A	G	10: 24,809,916	S194P	probably damaging	Het
Entpd8	C	T	2: 25,085,045	R463W	probably benign	Het
Fam169a	A	G	13: 97,118,496	T407A	probably benign	Het
Fam98b	G	T	2: 117,259,298	V99F	possibly damaging	Het
Foxn3	T	A	12: 99,196,428	K405*	probably null	Het
Gm340	T	A	19: 41,585,039	H744Q	probably damaging	Het
Gsdmc	T	C	15: 63,801,957	T160A	probably benign	Het
Hdac1	T	C	4: 129,528,923		probably null	Het
Igfbp1	A	C	11: 7,201,892	T232P	probably damaging	Het
Mertk	G	C	2: 128,801,314	G878R	possibly damaging	Het
Metap2	G	T	10: 93,868,922	P281H	possibly damaging	Het
Metap2	T	A	10: 93,868,932	T278S	probably benign	Het
Mfn1	T	C	3: 32,564,205	V169A	probably benign	Het
Mms22l	A	G	4: 24,578,774	D751G	probably damaging	Het
Mpl	A	G	4: 118,455,721	V138A	probably benign	Het
Myef2	T	A	2: 125,095,721	K533N	probably damaging	Het
Mylk3	C	T	8: 85,355,442	G309E	probably damaging	Het
Nid1	T	C	13: 13,468,572	V365A	probably damaging	Het
Olfr27	T	C	9: 39,144,315	C72R	probably damaging	Het
Olfr463	A	T	11: 87,893,192	I244N	probably damaging	Het
Olfr480	A	T	7: 108,066,216	L164*	probably null	Het
Olfr77	C	A	9: 19,920,621	N137K	possibly damaging	Het
Pbrm1	A	G	14: 31,106,184	K1323E	probably damaging	Het
Pcdhga12	G	A	18: 37,766,675	D187N	possibly damaging	Het
Phrf1	T	C	7: 141,259,283		probably benign	Het
Phtf2	A	G	5: 20,772,197	V608A	probably benign	Het
Plec	G	A	15: 76,173,438	R4122W	probably damaging	Het
Polm	A	G	11: 5,829,393	S441P	probably benign	Het
Prrc2b	T	A	2: 32,214,722	V1404E	probably benign	Het
Ptger1	T	G	8: 83,669,345	S344A	possibly damaging	Het
Rasef	A	T	4: 73,735,767	D401E	probably null	Het
Rbfox3	T	C	11: 118,496,352	Y312C	probably damaging	Het
Rbm48	A	G	5: 3,584,759	C402R	probably benign	Het
Rhbdl3	G	A	11: 80,319,666	A82T	probably benign	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Homo
Sidt2	T	A	9: 45,954,777	N44Y	probably damaging	Het
Slf2	T	A	19: 44,935,161	L138Q	possibly damaging	Het
Spag16	T	C	1: 69,896,583		probably null	Het
Sspo	C	T	6: 48,490,467	P4188S	probably damaging	Het
Synm	C	T	7: 67,734,689	S1075N	probably benign	Het
Tacc2	G	T	7: 130,729,317	D2151Y	probably damaging	Het
Tbc1d32	C	A	10: 56,151,818	L729F	probably damaging	Het
Tnfsf4	A	G	1: 161,417,013	N91S	possibly damaging	Het
Trim63	G	A	4: 134,323,133	E243K	probably benign	Het
Trim72	T	G	7: 128,004,542	L20R	probably damaging	Het
Tubb1	A	G	2: 174,457,424	M300V	probably damaging	Het
Ubfd1	C	T	7: 122,068,868	A207V	probably damaging	Het
Usp16	T	A	16: 87,470,451		probably null	Het
Vmn2r23	A	G	6: 123,712,977	T271A	possibly damaging	Het
Vmn2r72	T	A	7: 85,738,254	I701F	possibly damaging	Het
Wdfy4	A	G	14: 33,047,275	Y2078H	probably damaging	Het
Wdr41	T	C	13: 95,017,450		probably null	Het
Zfp955b	A	G	17: 33,303,057	Y500C	probably damaging	Het

Other mutations in Rnf123

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Rnf123	APN	9	108067395	critical splice donor site	probably null
IGL01358:Rnf123	APN	9	108069182	missense	probably damaging	1.00
IGL01464:Rnf123	APN	9	108052302	missense	probably damaging	1.00
IGL01637:Rnf123	APN	9	108058238	missense	probably damaging	1.00
IGL01669:Rnf123	APN	9	108058356	missense	probably damaging	0.98
IGL01905:Rnf123	APN	9	108071370	splice site	probably benign
IGL02070:Rnf123	APN	9	108068302	nonsense	probably null
IGL02072:Rnf123	APN	9	108068302	nonsense	probably null
IGL02073:Rnf123	APN	9	108068302	nonsense	probably null
IGL02074:Rnf123	APN	9	108066889	missense	probably damaging	1.00
IGL02079:Rnf123	APN	9	108068302	nonsense	probably null
IGL02080:Rnf123	APN	9	108068302	nonsense	probably null
IGL02231:Rnf123	APN	9	108066399	missense	probably benign	0.17
IGL02281:Rnf123	APN	9	108071452	missense	probably benign	0.01
IGL02336:Rnf123	APN	9	108061842	missense	probably damaging	1.00
IGL02543:Rnf123	APN	9	108066348	missense	probably damaging	1.00
IGL02565:Rnf123	APN	9	108052212	critical splice donor site	probably null
IGL02571:Rnf123	APN	9	108068302	nonsense	probably null
IGL02572:Rnf123	APN	9	108068302	nonsense	probably null
IGL02574:Rnf123	APN	9	108068302	nonsense	probably null
IGL02586:Rnf123	APN	9	108068302	nonsense	probably null
IGL02589:Rnf123	APN	9	108068302	nonsense	probably null
IGL02600:Rnf123	APN	9	108068302	nonsense	probably null
IGL02601:Rnf123	APN	9	108068302	nonsense	probably null
IGL02602:Rnf123	APN	9	108068302	nonsense	probably null
IGL02603:Rnf123	APN	9	108068302	nonsense	probably null
IGL02609:Rnf123	APN	9	108068302	nonsense	probably null
IGL02628:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108070789	splice site	probably benign
IGL02630:Rnf123	APN	9	108068302	nonsense	probably null
IGL02631:Rnf123	APN	9	108068302	nonsense	probably null
IGL02632:Rnf123	APN	9	108068302	nonsense	probably null
IGL02650:Rnf123	APN	9	108069748	missense	probably benign	0.29
IGL02690:Rnf123	APN	9	108068302	nonsense	probably null
IGL02691:Rnf123	APN	9	108068302	nonsense	probably null
IGL02692:Rnf123	APN	9	108068302	nonsense	probably null
IGL02693:Rnf123	APN	9	108068302	nonsense	probably null
IGL02713:Rnf123	APN	9	108068302	nonsense	probably null
IGL02736:Rnf123	APN	9	108068302	nonsense	probably null
IGL02929:Rnf123	APN	9	108069076	missense	probably benign
R1175:Rnf123	UTSW	9	108077373	missense	probably benign
R1465:Rnf123	UTSW	9	108071466	splice site	probably benign
R1502:Rnf123	UTSW	9	108068510	splice site	probably null
R1682:Rnf123	UTSW	9	108077398	missense	probably benign	0.16
R1817:Rnf123	UTSW	9	108062926	missense	probably benign	0.41
R1855:Rnf123	UTSW	9	108061791	missense	probably damaging	1.00
R2394:Rnf123	UTSW	9	108063536	missense	probably benign	0.00
R2483:Rnf123	UTSW	9	108063521	missense	probably benign	0.16
R3896:Rnf123	UTSW	9	108069103	splice site	probably benign
R3940:Rnf123	UTSW	9	108064035	splice site	probably benign
R4206:Rnf123	UTSW	9	108063963	missense	probably benign	0.01
R4641:Rnf123	UTSW	9	108058587	missense	probably damaging	1.00
R4714:Rnf123	UTSW	9	108052439	splice site	probably null
R4767:Rnf123	UTSW	9	108052089	missense	probably damaging	1.00
R4849:Rnf123	UTSW	9	108056091	missense	probably damaging	1.00
R4899:Rnf123	UTSW	9	108063680	missense	probably damaging	1.00
R5274:Rnf123	UTSW	9	108064003	frame shift	probably null
R5275:Rnf123	UTSW	9	108064003	frame shift	probably null
R5294:Rnf123	UTSW	9	108064003	frame shift	probably null
R5295:Rnf123	UTSW	9	108064003	frame shift	probably null
R5394:Rnf123	UTSW	9	108070731	missense	probably damaging	1.00
R5717:Rnf123	UTSW	9	108067424	missense	probably damaging	1.00
R6186:Rnf123	UTSW	9	108069958	missense	possibly damaging	0.55
R6449:Rnf123	UTSW	9	108056053	missense	probably benign	0.17
R6502:Rnf123	UTSW	9	108068332	missense	possibly damaging	0.46
R6944:Rnf123	UTSW	9	108063623	missense	probably benign	0.02
R7003:Rnf123	UTSW	9	108063683	critical splice acceptor site	probably null
R7088:Rnf123	UTSW	9	108058536	missense	probably null	1.00
R7092:Rnf123	UTSW	9	108068600	missense	probably benign	0.07
R7100:Rnf123	UTSW	9	108056639	missense	probably damaging	1.00
R7257:Rnf123	UTSW	9	108069029	missense	probably damaging	1.00
R7453:Rnf123	UTSW	9	108070408	splice site	probably null
R7468:Rnf123	UTSW	9	108069009	missense	probably benign	0.00
R7517:Rnf123	UTSW	9	108070274	nonsense	probably null
R7577:Rnf123	UTSW	9	108070619	missense	probably damaging	1.00
R8296:Rnf123	UTSW	9	108062890	missense	probably damaging	1.00
R8322:Rnf123	UTSW	9	108068507	missense	probably benign	0.26
R8754:Rnf123	UTSW	9	108071164	missense	probably damaging	1.00
R8783:Rnf123	UTSW	9	108069073	missense	probably benign
R9052:Rnf123	UTSW	9	108059731	missense	probably damaging	1.00
R9156:Rnf123	UTSW	9	108063028	splice site	probably benign
R9170:Rnf123	UTSW	9	108071176	missense	probably damaging	1.00
R9332:Rnf123	UTSW	9	108067505	missense	probably benign	0.00
R9385:Rnf123	UTSW	9	108052268	missense	probably benign	0.02
R9394:Rnf123	UTSW	9	108065706	missense	probably damaging	1.00
R9432:Rnf123	UTSW	9	108059809	missense	probably damaging	0.96
R9717:Rnf123	UTSW	9	108077764	missense	probably benign	0.43
Z1176:Rnf123	UTSW	9	108058395	missense	probably damaging	1.00
Z1176:Rnf123	UTSW	9	108062981	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCCTACACGGAGAGAAGC -3'
(R):5'- CATGGGGCTCTCTAATGAGG -3'

Sequencing Primer
(F):5'- AAGCCGGACCTGGGTCATAC -3'
(R):5'- GGCCCTCTGAGATGTAGACAG -3'

Posted On

2016-07-22