Incidental Mutation 'R5276:Enpp3'
ID403956
Institutional Source Beutler Lab
Gene Symbol Enpp3
Ensembl Gene ENSMUSG00000019989
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 3
SynonymsCD203c
MMRRC Submission 042863-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R5276 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location24772406-24842823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24809916 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 194 (S194P)
Ref Sequence ENSEMBL: ENSMUSP00000020169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020169] [ENSMUST00000217903] [ENSMUST00000219342]
Predicted Effect probably damaging
Transcript: ENSMUST00000020169
AA Change: S194P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: S194P

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
SO 50 93 1.99e-13 SMART
SO 94 137 7.66e-15 SMART
Pfam:Phosphodiest 161 485 1.7e-87 PFAM
Blast:Endonuclease_NS 543 599 9e-15 BLAST
Endonuclease_NS 626 847 5.41e-16 SMART
NUC 627 856 1.54e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218619
Predicted Effect possibly damaging
Transcript: ENSMUST00000219342
AA Change: S29P

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A G 8: 43,570,420 F11S probably benign Het
Adipor2 T A 6: 119,357,221 I343F probably damaging Het
Ahdc1 C T 4: 133,062,798 P450L possibly damaging Het
Akna A C 4: 63,368,203 V1353G possibly damaging Het
Baz2b G A 2: 59,962,614 T390I probably benign Het
Btbd7 T C 12: 102,838,392 K130E probably benign Het
Cdc42bpa A G 1: 180,137,850 Y1101C probably damaging Het
Crlf2 T G 5: 109,557,635 probably benign Het
Ddx59 A T 1: 136,419,448 R281S probably damaging Het
Dgcr8 T G 16: 18,283,771 T216P probably benign Het
Dsg4 A T 18: 20,446,839 I34F probably benign Het
Entpd8 C T 2: 25,085,045 R463W probably benign Het
Fam169a A G 13: 97,118,496 T407A probably benign Het
Fam98b G T 2: 117,259,298 V99F possibly damaging Het
Foxn3 T A 12: 99,196,428 K405* probably null Het
Gm340 T A 19: 41,585,039 H744Q probably damaging Het
Gsdmc T C 15: 63,801,957 T160A probably benign Het
Hdac1 T C 4: 129,528,923 probably null Het
Igfbp1 A C 11: 7,201,892 T232P probably damaging Het
Mertk G C 2: 128,801,314 G878R possibly damaging Het
Metap2 G T 10: 93,868,922 P281H possibly damaging Het
Metap2 T A 10: 93,868,932 T278S probably benign Het
Mfn1 T C 3: 32,564,205 V169A probably benign Het
Mms22l A G 4: 24,578,774 D751G probably damaging Het
Mpl A G 4: 118,455,721 V138A probably benign Het
Myef2 T A 2: 125,095,721 K533N probably damaging Het
Mylk3 C T 8: 85,355,442 G309E probably damaging Het
Nid1 T C 13: 13,468,572 V365A probably damaging Het
Olfr27 T C 9: 39,144,315 C72R probably damaging Het
Olfr463 A T 11: 87,893,192 I244N probably damaging Het
Olfr480 A T 7: 108,066,216 L164* probably null Het
Olfr77 C A 9: 19,920,621 N137K possibly damaging Het
Pbrm1 A G 14: 31,106,184 K1323E probably damaging Het
Pcdhga12 G A 18: 37,766,675 D187N possibly damaging Het
Phrf1 T C 7: 141,259,283 probably benign Het
Phtf2 A G 5: 20,772,197 V608A probably benign Het
Plec G A 15: 76,173,438 R4122W probably damaging Het
Polm A G 11: 5,829,393 S441P probably benign Het
Prrc2b T A 2: 32,214,722 V1404E probably benign Het
Ptger1 T G 8: 83,669,345 S344A possibly damaging Het
Rasef A T 4: 73,735,767 D401E probably null Het
Rbfox3 T C 11: 118,496,352 Y312C probably damaging Het
Rbm48 A G 5: 3,584,759 C402R probably benign Het
Rhbdl3 G A 11: 80,319,666 A82T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sidt2 T A 9: 45,954,777 N44Y probably damaging Het
Slf2 T A 19: 44,935,161 L138Q possibly damaging Het
Spag16 T C 1: 69,896,583 probably null Het
Sspo C T 6: 48,490,467 P4188S probably damaging Het
Synm C T 7: 67,734,689 S1075N probably benign Het
Tacc2 G T 7: 130,729,317 D2151Y probably damaging Het
Tbc1d32 C A 10: 56,151,818 L729F probably damaging Het
Tnfsf4 A G 1: 161,417,013 N91S possibly damaging Het
Trim63 G A 4: 134,323,133 E243K probably benign Het
Trim72 T G 7: 128,004,542 L20R probably damaging Het
Tubb1 A G 2: 174,457,424 M300V probably damaging Het
Ubfd1 C T 7: 122,068,868 A207V probably damaging Het
Usp16 T A 16: 87,470,451 probably null Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Vmn2r72 T A 7: 85,738,254 I701F possibly damaging Het
Wdfy4 A G 14: 33,047,275 Y2078H probably damaging Het
Wdr41 T C 13: 95,017,450 probably null Het
Zfp955b A G 17: 33,303,057 Y500C probably damaging Het
Other mutations in Enpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Enpp3 APN 10 24787772 missense probably benign 0.00
IGL00778:Enpp3 APN 10 24798262 missense probably damaging 1.00
IGL01147:Enpp3 APN 10 24774907 missense probably damaging 1.00
IGL01343:Enpp3 APN 10 24805922 nonsense probably null
IGL01642:Enpp3 APN 10 24798269 missense probably damaging 1.00
IGL01814:Enpp3 APN 10 24792025 missense possibly damaging 0.68
IGL02083:Enpp3 APN 10 24776794 missense probably damaging 1.00
IGL02152:Enpp3 APN 10 24774002 missense probably damaging 1.00
IGL02186:Enpp3 APN 10 24791983 splice site probably benign
IGL02517:Enpp3 APN 10 24809848 splice site probably benign
IGL02956:Enpp3 APN 10 24774943 splice site probably benign
R0017:Enpp3 UTSW 10 24799153 splice site probably null
R0042:Enpp3 UTSW 10 24774824 missense probably damaging 1.00
R0110:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0218:Enpp3 UTSW 10 24776869 missense possibly damaging 0.80
R0403:Enpp3 UTSW 10 24804436 missense probably damaging 1.00
R0433:Enpp3 UTSW 10 24820597 missense probably benign 0.00
R0450:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0510:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0826:Enpp3 UTSW 10 24795716 missense probably damaging 1.00
R1245:Enpp3 UTSW 10 24784953 splice site probably benign
R1261:Enpp3 UTSW 10 24774934 missense probably damaging 0.97
R1633:Enpp3 UTSW 10 24795782 missense probably damaging 1.00
R1903:Enpp3 UTSW 10 24778789 missense probably damaging 1.00
R1913:Enpp3 UTSW 10 24776771 nonsense probably null
R1966:Enpp3 UTSW 10 24807491 missense probably damaging 0.99
R2157:Enpp3 UTSW 10 24776878 missense probably damaging 1.00
R2179:Enpp3 UTSW 10 24805895 missense probably benign 0.00
R2380:Enpp3 UTSW 10 24776872 missense probably benign
R2410:Enpp3 UTSW 10 24774818 missense probably benign 0.00
R3794:Enpp3 UTSW 10 24831732 splice site probably null
R3896:Enpp3 UTSW 10 24777949 missense possibly damaging 0.79
R4334:Enpp3 UTSW 10 24793589 missense probably damaging 1.00
R4569:Enpp3 UTSW 10 24776882 missense probably damaging 1.00
R4766:Enpp3 UTSW 10 24773927 missense probably damaging 1.00
R4951:Enpp3 UTSW 10 24798277 missense probably damaging 1.00
R4998:Enpp3 UTSW 10 24807538 missense probably benign 0.01
R5045:Enpp3 UTSW 10 24776767 missense probably damaging 1.00
R5331:Enpp3 UTSW 10 24808160 missense probably damaging 1.00
R5569:Enpp3 UTSW 10 24778821 missense probably damaging 0.98
R5975:Enpp3 UTSW 10 24774842 missense probably benign 0.37
R6117:Enpp3 UTSW 10 24787852 missense probably damaging 1.00
R6419:Enpp3 UTSW 10 24808191 missense probably damaging 1.00
R6677:Enpp3 UTSW 10 24777957 missense possibly damaging 0.88
R6735:Enpp3 UTSW 10 24807453 missense probably damaging 1.00
R6833:Enpp3 UTSW 10 24809870 missense probably damaging 1.00
R6999:Enpp3 UTSW 10 24808166 missense probably damaging 1.00
R7022:Enpp3 UTSW 10 24826195 missense probably damaging 0.99
R7173:Enpp3 UTSW 10 24774047 missense probably damaging 1.00
R7224:Enpp3 UTSW 10 24776884 missense possibly damaging 0.63
R7227:Enpp3 UTSW 10 24817844 missense unknown
R7487:Enpp3 UTSW 10 24805923 missense probably benign 0.02
R7529:Enpp3 UTSW 10 24798174 missense probably damaging 0.97
R7583:Enpp3 UTSW 10 24836092 start codon destroyed probably null 0.83
R7692:Enpp3 UTSW 10 24784841 nonsense probably null
X0026:Enpp3 UTSW 10 24826242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATAGAGAACACCGAGCC -3'
(R):5'- AAAGCCCATTTGACTCCCAG -3'

Sequencing Primer
(F):5'- AGCCTGGATTCAGTGGTGCAC -3'
(R):5'- GCCCATTTGACTCCCAGAAATGG -3'
Posted On2016-07-22