Mutagenetix > Incidental Mutation

Incidental Mutation 'R5276:Tbc1d32'

403958

Institutional Source

Beutler Lab

Gene Symbol

Tbc1d32

Ensembl Gene

ENSMUSG00000038122

Gene Name

TBC1 domain family, member 32

Synonyms

D630037F22Rik, C6orf170, Bromi, b2b2284Clo

MMRRC Submission

042863-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.903) question?

Stock #

R5276 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56014293-56228689 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 56151818 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 729 (L729F)

Ref Sequence

ENSEMBL: ENSMUSP00000097328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099739]

AlphaFold

Q3URV1

Predicted Effect

probably damaging
Transcript: ENSMUST00000099739
AA Change: L729F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: L729F

Domain	Start	End	E-Value	Type
Pfam:BROMI	12	1293	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217792

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219385

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26a	A	G	8: 43,570,420	F11S	probably benign	Het
Adipor2	T	A	6: 119,357,221	I343F	probably damaging	Het
Ahdc1	C	T	4: 133,062,798	P450L	possibly damaging	Het
Akna	A	C	4: 63,368,203	V1353G	possibly damaging	Het
Baz2b	G	A	2: 59,962,614	T390I	probably benign	Het
Btbd7	T	C	12: 102,838,392	K130E	probably benign	Het
Cdc42bpa	A	G	1: 180,137,850	Y1101C	probably damaging	Het
Crlf2	T	G	5: 109,557,635		probably benign	Het
Ddx59	A	T	1: 136,419,448	R281S	probably damaging	Het
Dgcr8	T	G	16: 18,283,771	T216P	probably benign	Het
Dsg4	A	T	18: 20,446,839	I34F	probably benign	Het
Enpp3	A	G	10: 24,809,916	S194P	probably damaging	Het
Entpd8	C	T	2: 25,085,045	R463W	probably benign	Het
Fam169a	A	G	13: 97,118,496	T407A	probably benign	Het
Fam98b	G	T	2: 117,259,298	V99F	possibly damaging	Het
Foxn3	T	A	12: 99,196,428	K405*	probably null	Het
Gm340	T	A	19: 41,585,039	H744Q	probably damaging	Het
Gsdmc	T	C	15: 63,801,957	T160A	probably benign	Het
Hdac1	T	C	4: 129,528,923		probably null	Het
Igfbp1	A	C	11: 7,201,892	T232P	probably damaging	Het
Mertk	G	C	2: 128,801,314	G878R	possibly damaging	Het
Metap2	G	T	10: 93,868,922	P281H	possibly damaging	Het
Metap2	T	A	10: 93,868,932	T278S	probably benign	Het
Mfn1	T	C	3: 32,564,205	V169A	probably benign	Het
Mms22l	A	G	4: 24,578,774	D751G	probably damaging	Het
Mpl	A	G	4: 118,455,721	V138A	probably benign	Het
Myef2	T	A	2: 125,095,721	K533N	probably damaging	Het
Mylk3	C	T	8: 85,355,442	G309E	probably damaging	Het
Nid1	T	C	13: 13,468,572	V365A	probably damaging	Het
Olfr27	T	C	9: 39,144,315	C72R	probably damaging	Het
Olfr463	A	T	11: 87,893,192	I244N	probably damaging	Het
Olfr480	A	T	7: 108,066,216	L164*	probably null	Het
Olfr77	C	A	9: 19,920,621	N137K	possibly damaging	Het
Pbrm1	A	G	14: 31,106,184	K1323E	probably damaging	Het
Pcdhga12	G	A	18: 37,766,675	D187N	possibly damaging	Het
Phrf1	T	C	7: 141,259,283		probably benign	Het
Phtf2	A	G	5: 20,772,197	V608A	probably benign	Het
Plec	G	A	15: 76,173,438	R4122W	probably damaging	Het
Polm	A	G	11: 5,829,393	S441P	probably benign	Het
Prrc2b	T	A	2: 32,214,722	V1404E	probably benign	Het
Ptger1	T	G	8: 83,669,345	S344A	possibly damaging	Het
Rasef	A	T	4: 73,735,767	D401E	probably null	Het
Rbfox3	T	C	11: 118,496,352	Y312C	probably damaging	Het
Rbm48	A	G	5: 3,584,759	C402R	probably benign	Het
Rhbdl3	G	A	11: 80,319,666	A82T	probably benign	Het
Rnf123	AT	ATT	9: 108,064,003		probably null	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Homo
Sidt2	T	A	9: 45,954,777	N44Y	probably damaging	Het
Slf2	T	A	19: 44,935,161	L138Q	possibly damaging	Het
Spag16	T	C	1: 69,896,583		probably null	Het
Sspo	C	T	6: 48,490,467	P4188S	probably damaging	Het
Synm	C	T	7: 67,734,689	S1075N	probably benign	Het
Tacc2	G	T	7: 130,729,317	D2151Y	probably damaging	Het
Tnfsf4	A	G	1: 161,417,013	N91S	possibly damaging	Het
Trim63	G	A	4: 134,323,133	E243K	probably benign	Het
Trim72	T	G	7: 128,004,542	L20R	probably damaging	Het
Tubb1	A	G	2: 174,457,424	M300V	probably damaging	Het
Ubfd1	C	T	7: 122,068,868	A207V	probably damaging	Het
Usp16	T	A	16: 87,470,451		probably null	Het
Vmn2r23	A	G	6: 123,712,977	T271A	possibly damaging	Het
Vmn2r72	T	A	7: 85,738,254	I701F	possibly damaging	Het
Wdfy4	A	G	14: 33,047,275	Y2078H	probably damaging	Het
Wdr41	T	C	13: 95,017,450		probably null	Het
Zfp955b	A	G	17: 33,303,057	Y500C	probably damaging	Het

Other mutations in Tbc1d32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Tbc1d32	APN	10	56155765	missense	probably damaging	1.00
IGL00535:Tbc1d32	APN	10	56215125	splice site	probably benign
IGL00835:Tbc1d32	APN	10	56089846	splice site	probably benign
IGL01013:Tbc1d32	APN	10	56201959	splice site	probably null
IGL01306:Tbc1d32	APN	10	56180524	missense	probably benign	0.14
IGL01452:Tbc1d32	APN	10	56215080	missense	possibly damaging	0.71
IGL01668:Tbc1d32	APN	10	56123577	missense	probably benign	0.37
IGL02008:Tbc1d32	APN	10	56151775	missense	possibly damaging	0.71
IGL02076:Tbc1d32	APN	10	56088403	missense	possibly damaging	0.93
IGL02348:Tbc1d32	APN	10	56224619	missense	probably benign	0.06
IGL02476:Tbc1d32	APN	10	56198542	missense	possibly damaging	0.71
IGL02750:Tbc1d32	APN	10	56198491	missense	possibly damaging	0.95
IGL02893:Tbc1d32	APN	10	56017703	missense	probably damaging	0.98
ANU23:Tbc1d32	UTSW	10	56180524	missense	probably benign	0.14
P0035:Tbc1d32	UTSW	10	56198439	missense	probably damaging	1.00
R0118:Tbc1d32	UTSW	10	56017605	missense	probably benign	0.02
R0446:Tbc1d32	UTSW	10	56192898	missense	possibly damaging	0.93
R0567:Tbc1d32	UTSW	10	56173963	missense	possibly damaging	0.71
R0615:Tbc1d32	UTSW	10	56224640	missense	probably benign	0.33
R0679:Tbc1d32	UTSW	10	56180576	missense	probably damaging	0.99
R0943:Tbc1d32	UTSW	10	56161147	missense	probably benign
R1432:Tbc1d32	UTSW	10	56017662	missense	probably damaging	0.99
R1454:Tbc1d32	UTSW	10	56177479	splice site	probably benign
R1708:Tbc1d32	UTSW	10	56151769	missense	possibly damaging	0.84
R1834:Tbc1d32	UTSW	10	56017604	missense	probably benign	0.00
R1860:Tbc1d32	UTSW	10	56123537	nonsense	probably null
R2208:Tbc1d32	UTSW	10	56150792	critical splice donor site	probably null
R3012:Tbc1d32	UTSW	10	56173915	missense	probably benign	0.08
R3736:Tbc1d32	UTSW	10	56129093	missense	probably damaging	0.99
R4184:Tbc1d32	UTSW	10	56224580	missense	probably benign	0.15
R4259:Tbc1d32	UTSW	10	56049771	missense	probably damaging	0.97
R4617:Tbc1d32	UTSW	10	56170904	missense	possibly damaging	0.92
R4700:Tbc1d32	UTSW	10	56224649	missense	probably damaging	0.98
R4794:Tbc1d32	UTSW	10	56196836	missense	possibly damaging	0.92
R4879:Tbc1d32	UTSW	10	56049029	splice site	probably null
R5031:Tbc1d32	UTSW	10	56123531	missense	probably damaging	0.98
R5036:Tbc1d32	UTSW	10	56195404	nonsense	probably null
R5358:Tbc1d32	UTSW	10	56170937	missense	possibly damaging	0.93
R5429:Tbc1d32	UTSW	10	56027993	missense	probably damaging	0.99
R5435:Tbc1d32	UTSW	10	56040150	missense	probably damaging	0.98
R5451:Tbc1d32	UTSW	10	56195475	missense	possibly damaging	0.95
R5607:Tbc1d32	UTSW	10	56129150	missense	possibly damaging	0.92
R5642:Tbc1d32	UTSW	10	56150877	missense	possibly damaging	0.82
R5732:Tbc1d32	UTSW	10	56088393	missense	probably damaging	0.99
R5795:Tbc1d32	UTSW	10	56215062	missense	possibly damaging	0.71
R5988:Tbc1d32	UTSW	10	56088337	missense	probably damaging	0.98
R6054:Tbc1d32	UTSW	10	56162208	missense	possibly damaging	0.95
R6103:Tbc1d32	UTSW	10	56150883	missense	probably damaging	0.99
R6277:Tbc1d32	UTSW	10	56195429	missense	probably benign
R6422:Tbc1d32	UTSW	10	56028061	nonsense	probably null
R6508:Tbc1d32	UTSW	10	56224690	missense	probably damaging	0.98
R6859:Tbc1d32	UTSW	10	56180530	missense	probably damaging	0.98
R6887:Tbc1d32	UTSW	10	56151811	nonsense	probably null
R7012:Tbc1d32	UTSW	10	56224724	missense	probably damaging	0.99
R7253:Tbc1d32	UTSW	10	56198441	missense	probably benign
R7288:Tbc1d32	UTSW	10	56051387	critical splice donor site	probably null
R7599:Tbc1d32	UTSW	10	56151833	missense	possibly damaging	0.92
R8338:Tbc1d32	UTSW	10	56028077	missense	possibly damaging	0.85
R8814:Tbc1d32	UTSW	10	56196592	missense	possibly damaging	0.93
R8864:Tbc1d32	UTSW	10	56087559	missense	probably benign	0.01
R9018:Tbc1d32	UTSW	10	56072597	missense	probably benign	0.02
R9030:Tbc1d32	UTSW	10	56161145	missense	possibly damaging	0.92
R9530:Tbc1d32	UTSW	10	56196411	missense	probably damaging	0.98
R9616:Tbc1d32	UTSW	10	56161150	missense	possibly damaging	0.85
Z1188:Tbc1d32	UTSW	10	56170881	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCAACATAGTCACAAACTGGGAAG -3'
(R):5'- GCTAGGCTTAAACTCAAACCAGAAG -3'

Sequencing Primer
(F):5'- TCACAAACTGGGAAGTAGAATTTTAG -3'
(R):5'- GGTACTAATTCACTGTAAGGGTTTC -3'

Posted On

2016-07-22