Incidental Mutation 'R5276:Btbd7'
ID 403965
Institutional Source Beutler Lab
Gene Symbol Btbd7
Ensembl Gene ENSMUSG00000041702
Gene Name BTB (POZ) domain containing 7
Synonyms FUP1, E130118E17Rik, 5730507E09Rik
MMRRC Submission 042863-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock # R5276 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 102780797-102878471 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102838392 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 130 (K130E)
Ref Sequence ENSEMBL: ENSMUSP00000152426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045652] [ENSMUST00000223554]
AlphaFold Q8CFE5
Predicted Effect probably benign
Transcript: ENSMUST00000045652
AA Change: K130E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000046951
Gene: ENSMUSG00000041702
AA Change: K130E

DomainStartEndE-ValueType
BTB 142 244 1.57e-13 SMART
BTB 247 397 2.23e-4 SMART
BACK 402 538 1.49e-4 SMART
low complexity region 626 640 N/A INTRINSIC
low complexity region 756 771 N/A INTRINSIC
low complexity region 783 792 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 839 850 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221925
Predicted Effect probably benign
Transcript: ENSMUST00000223554
AA Change: K130E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A G 8: 43,570,420 F11S probably benign Het
Adipor2 T A 6: 119,357,221 I343F probably damaging Het
Ahdc1 C T 4: 133,062,798 P450L possibly damaging Het
Akna A C 4: 63,368,203 V1353G possibly damaging Het
Baz2b G A 2: 59,962,614 T390I probably benign Het
Cdc42bpa A G 1: 180,137,850 Y1101C probably damaging Het
Crlf2 T G 5: 109,557,635 probably benign Het
Ddx59 A T 1: 136,419,448 R281S probably damaging Het
Dgcr8 T G 16: 18,283,771 T216P probably benign Het
Dsg4 A T 18: 20,446,839 I34F probably benign Het
Enpp3 A G 10: 24,809,916 S194P probably damaging Het
Entpd8 C T 2: 25,085,045 R463W probably benign Het
Fam169a A G 13: 97,118,496 T407A probably benign Het
Fam98b G T 2: 117,259,298 V99F possibly damaging Het
Foxn3 T A 12: 99,196,428 K405* probably null Het
Gm340 T A 19: 41,585,039 H744Q probably damaging Het
Gsdmc T C 15: 63,801,957 T160A probably benign Het
Hdac1 T C 4: 129,528,923 probably null Het
Igfbp1 A C 11: 7,201,892 T232P probably damaging Het
Mertk G C 2: 128,801,314 G878R possibly damaging Het
Metap2 G T 10: 93,868,922 P281H possibly damaging Het
Metap2 T A 10: 93,868,932 T278S probably benign Het
Mfn1 T C 3: 32,564,205 V169A probably benign Het
Mms22l A G 4: 24,578,774 D751G probably damaging Het
Mpl A G 4: 118,455,721 V138A probably benign Het
Myef2 T A 2: 125,095,721 K533N probably damaging Het
Mylk3 C T 8: 85,355,442 G309E probably damaging Het
Nid1 T C 13: 13,468,572 V365A probably damaging Het
Olfr27 T C 9: 39,144,315 C72R probably damaging Het
Olfr463 A T 11: 87,893,192 I244N probably damaging Het
Olfr480 A T 7: 108,066,216 L164* probably null Het
Olfr77 C A 9: 19,920,621 N137K possibly damaging Het
Pbrm1 A G 14: 31,106,184 K1323E probably damaging Het
Pcdhga12 G A 18: 37,766,675 D187N possibly damaging Het
Phrf1 T C 7: 141,259,283 probably benign Het
Phtf2 A G 5: 20,772,197 V608A probably benign Het
Plec G A 15: 76,173,438 R4122W probably damaging Het
Polm A G 11: 5,829,393 S441P probably benign Het
Prrc2b T A 2: 32,214,722 V1404E probably benign Het
Ptger1 T G 8: 83,669,345 S344A possibly damaging Het
Rasef A T 4: 73,735,767 D401E probably null Het
Rbfox3 T C 11: 118,496,352 Y312C probably damaging Het
Rbm48 A G 5: 3,584,759 C402R probably benign Het
Rhbdl3 G A 11: 80,319,666 A82T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sidt2 T A 9: 45,954,777 N44Y probably damaging Het
Slf2 T A 19: 44,935,161 L138Q possibly damaging Het
Spag16 T C 1: 69,896,583 probably null Het
Sspo C T 6: 48,490,467 P4188S probably damaging Het
Synm C T 7: 67,734,689 S1075N probably benign Het
Tacc2 G T 7: 130,729,317 D2151Y probably damaging Het
Tbc1d32 C A 10: 56,151,818 L729F probably damaging Het
Tnfsf4 A G 1: 161,417,013 N91S possibly damaging Het
Trim63 G A 4: 134,323,133 E243K probably benign Het
Trim72 T G 7: 128,004,542 L20R probably damaging Het
Tubb1 A G 2: 174,457,424 M300V probably damaging Het
Ubfd1 C T 7: 122,068,868 A207V probably damaging Het
Usp16 T A 16: 87,470,451 probably null Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Vmn2r72 T A 7: 85,738,254 I701F possibly damaging Het
Wdfy4 A G 14: 33,047,275 Y2078H probably damaging Het
Wdr41 T C 13: 95,017,450 probably null Het
Zfp955b A G 17: 33,303,057 Y500C probably damaging Het
Other mutations in Btbd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02047:Btbd7 APN 12 102793779 missense probably benign 0.10
IGL02899:Btbd7 APN 12 102837662 missense probably damaging 1.00
IGL03204:Btbd7 APN 12 102807980 nonsense probably null
H8562:Btbd7 UTSW 12 102788302 missense probably benign 0.26
IGL03050:Btbd7 UTSW 12 102812806 missense probably benign 0.03
R1262:Btbd7 UTSW 12 102787951 missense probably benign
R1423:Btbd7 UTSW 12 102785475 missense possibly damaging 0.49
R1437:Btbd7 UTSW 12 102788090 missense possibly damaging 0.59
R1636:Btbd7 UTSW 12 102793851 missense probably damaging 1.00
R1641:Btbd7 UTSW 12 102790775 missense probably damaging 1.00
R1722:Btbd7 UTSW 12 102812654 missense possibly damaging 0.96
R1921:Btbd7 UTSW 12 102793796 missense probably benign 0.01
R2021:Btbd7 UTSW 12 102790709 missense probably damaging 1.00
R2180:Btbd7 UTSW 12 102785897 missense probably damaging 1.00
R3768:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3770:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3786:Btbd7 UTSW 12 102838152 missense probably benign 0.22
R4396:Btbd7 UTSW 12 102785293 missense probably benign 0.00
R4809:Btbd7 UTSW 12 102793744 critical splice donor site probably null
R4910:Btbd7 UTSW 12 102808048 missense probably damaging 0.98
R4915:Btbd7 UTSW 12 102837787 nonsense probably null
R5054:Btbd7 UTSW 12 102838212 missense probably benign 0.02
R5387:Btbd7 UTSW 12 102837785 missense probably damaging 0.99
R5665:Btbd7 UTSW 12 102785197 missense probably benign
R7083:Btbd7 UTSW 12 102788335 missense probably damaging 0.99
R7354:Btbd7 UTSW 12 102838205 missense probably benign 0.05
R7429:Btbd7 UTSW 12 102837780 missense probably damaging 1.00
R7462:Btbd7 UTSW 12 102837722 missense possibly damaging 0.88
R7469:Btbd7 UTSW 12 102812768 missense probably damaging 0.99
R7998:Btbd7 UTSW 12 102795240 missense probably damaging 1.00
R8499:Btbd7 UTSW 12 102788372 missense probably damaging 1.00
R8773:Btbd7 UTSW 12 102837982 missense probably benign 0.02
R8783:Btbd7 UTSW 12 102788242 missense probably benign 0.45
R8968:Btbd7 UTSW 12 102812766 missense probably damaging 1.00
R9016:Btbd7 UTSW 12 102785158 missense probably damaging 1.00
R9027:Btbd7 UTSW 12 102838579 missense probably damaging 1.00
R9216:Btbd7 UTSW 12 102795304 missense probably damaging 1.00
R9221:Btbd7 UTSW 12 102811171 missense probably damaging 1.00
X0024:Btbd7 UTSW 12 102812686 nonsense probably null
X0025:Btbd7 UTSW 12 102811164 missense probably benign 0.06
Z1177:Btbd7 UTSW 12 102811120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATATCAATACCAGCTGTACTG -3'
(R):5'- AAAGAGAACCTCTGGCCTTGC -3'

Sequencing Primer
(F):5'- GTACTGATGTCCATTATTATCTCTGC -3'
(R):5'- GCCTTGCCACTCTCAAAAAG -3'
Posted On 2016-07-22