Incidental Mutation 'R0417:Prkcg'
ID 40397
Institutional Source Beutler Lab
Gene Symbol Prkcg
Ensembl Gene ENSMUSG00000078816
Gene Name protein kinase C, gamma
Synonyms Prkcc, PKCgamma, Pkcc
MMRRC Submission 038619-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0417 (G1)
Quality Score 195
Status Not validated
Chromosome 7
Chromosomal Location 3289179-3331099 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 3304304 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096744] [ENSMUST00000100301] [ENSMUST00000100301] [ENSMUST00000164553] [ENSMUST00000172109] [ENSMUST00000172109] [ENSMUST00000203566]
AlphaFold P63318
Predicted Effect probably benign
Transcript: ENSMUST00000096744
SMART Domains Protein: ENSMUSP00000094505
Gene: ENSMUSG00000068566

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 151 7.2e-16 PFAM
Pfam:MARVEL 162 311 1.6e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100301
SMART Domains Protein: ENSMUSP00000097874
Gene: ENSMUSG00000078816

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
C1 36 85 2.89e-16 SMART
C1 101 150 2.27e-14 SMART
C2 172 275 1.35e-26 SMART
low complexity region 319 331 N/A INTRINSIC
S_TKc 351 614 1.37e-94 SMART
S_TK_X 615 677 1.77e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100301
SMART Domains Protein: ENSMUSP00000097874
Gene: ENSMUSG00000078816

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
C1 36 85 2.89e-16 SMART
C1 101 150 2.27e-14 SMART
C2 172 275 1.35e-26 SMART
low complexity region 319 331 N/A INTRINSIC
S_TKc 351 614 1.37e-94 SMART
S_TK_X 615 677 1.77e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164553
SMART Domains Protein: ENSMUSP00000131318
Gene: ENSMUSG00000068566

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 151 5.6e-16 PFAM
Pfam:MARVEL 162 311 1.3e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172109
SMART Domains Protein: ENSMUSP00000131351
Gene: ENSMUSG00000078816

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
C1 36 85 2.89e-16 SMART
C1 101 150 2.27e-14 SMART
C2 172 275 1.35e-26 SMART
S_TKc 309 563 2.73e-80 SMART
S_TK_X 564 626 1.77e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000172109
SMART Domains Protein: ENSMUSP00000131351
Gene: ENSMUSG00000078816

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
C1 36 85 2.89e-16 SMART
C1 101 150 2.27e-14 SMART
C2 172 275 1.35e-26 SMART
S_TKc 309 563 2.73e-80 SMART
S_TK_X 564 626 1.77e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203081
Predicted Effect probably benign
Transcript: ENSMUST00000203566
SMART Domains Protein: ENSMUSP00000145120
Gene: ENSMUSG00000068566

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 151 5.6e-16 PFAM
Pfam:MARVEL 162 311 1.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203600
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase is expressed solely in the brain and spinal cord and its localization is restricted to neurons. It has been demonstrated that several neuronal functions, including long term potentiation (LTP) and long term depression (LTD), specifically require this kinase. Knockout studies in mice also suggest that this kinase may be involved in neuropathic pain development. Defects in this protein have been associated with neurodegenerative disorder spinocerebellar ataxia-14 (SCA14). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Depending upon genetic background, homozygous null mice show mild deficits in spatial learning and contextual conditioning. Genotype-dependent reductions in sensitivity to the effects of ethanol on righting reflex and hypothermia, in neuropathic pain after injury, and in anxiety are also evident. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik A G 7: 4,151,483 L102P probably damaging Het
1700030K09Rik A G 8: 72,445,400 K217R probably damaging Het
1810024B03Rik A G 2: 127,186,944 Y112H probably damaging Het
A430078G23Rik T C 8: 3,388,957 probably benign Het
Acot2 T C 12: 83,990,613 Y234H probably benign Het
Alox12e C T 11: 70,321,865 V53I probably benign Het
Ankrd50 T C 3: 38,456,361 H619R probably damaging Het
Arfgef3 A T 10: 18,603,511 L1452Q probably damaging Het
Arhgap42 T C 9: 9,180,033 S82G possibly damaging Het
Bicra C A 7: 15,972,322 R1398L probably damaging Het
Boc T C 16: 44,520,234 T118A probably benign Het
Btnl9 A G 11: 49,175,595 Y381H probably damaging Het
Cbln3 T G 14: 55,884,129 E20A probably benign Het
Csrnp3 A G 2: 66,019,543 Y171C probably benign Het
Cyp2d9 A T 15: 82,455,951 I181F probably damaging Het
Cyp7b1 T A 3: 18,096,691 T295S probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dok1 A T 6: 83,031,569 D377E probably damaging Het
Eed A T 7: 89,971,552 Y87* probably null Het
Entpd3 T C 9: 120,557,421 V156A probably damaging Het
Exo5 T A 4: 120,922,072 T199S probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Ezh2 A G 6: 47,551,726 C291R probably benign Het
Flvcr1 A T 1: 191,011,219 M466K probably benign Het
Fras1 G T 5: 96,691,372 M1583I probably benign Het
Fzd9 G T 5: 135,249,619 R471S probably damaging Het
Galr1 A T 18: 82,405,540 F204Y probably damaging Het
Gm38394 A T 1: 133,658,538 S354T probably benign Het
Gna11 A T 10: 81,530,904 I324N probably damaging Het
Gucy1a2 A G 9: 3,759,484 E430G possibly damaging Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Ikzf1 A C 11: 11,769,352 N353T probably benign Het
Il7 T A 3: 7,576,027 T110S probably damaging Het
Keg1 A G 19: 12,711,060 N53D probably damaging Het
Klhl21 T C 4: 152,015,507 I558T probably damaging Het
Lca5l G A 16: 96,162,653 T357M probably damaging Het
Lrba T C 3: 86,715,654 S2448P probably damaging Het
Map3k6 T A 4: 133,248,082 Y709* probably null Het
Megf6 A G 4: 154,267,967 E1261G probably benign Het
Mettl3 C T 14: 52,296,698 G473D probably damaging Het
Mga A G 2: 119,902,790 I40V probably damaging Het
Mmp13 T A 9: 7,276,602 D232E probably benign Het
Nampt T C 12: 32,833,101 V95A probably benign Het
Nbeal1 T C 1: 60,247,734 V905A probably benign Het
Nomo1 A T 7: 46,068,698 E840V possibly damaging Het
Nprl2 A T 9: 107,543,298 I101F probably damaging Het
Nup160 A T 2: 90,735,427 I1378F possibly damaging Het
Ogdhl T C 14: 32,326,979 S69P probably damaging Het
Olfr1105 A T 2: 87,033,445 Y259N probably damaging Het
Olfr1240 C A 2: 89,440,175 V35L possibly damaging Het
Olfr1283 A G 2: 111,369,105 S158G possibly damaging Het
Olfr1390 T A 11: 49,340,673 I47N possibly damaging Het
Olfr143 T C 9: 38,253,864 F149S probably benign Het
Olfr870 G A 9: 20,171,214 A119V probably damaging Het
Olfr894 A G 9: 38,219,455 I211V probably benign Het
Osbpl3 C T 6: 50,348,018 V167I probably benign Het
Pclo T A 5: 14,713,022 H3836Q unknown Het
Ror1 A T 4: 100,412,000 H345L possibly damaging Het
Slc36a2 C T 11: 55,181,544 probably null Het
Slc40a1 G A 1: 45,911,374 P306L possibly damaging Het
Slc9a8 C A 2: 167,457,344 T239K probably benign Het
Snapc3 A G 4: 83,450,162 I299V probably benign Het
Sp3 G A 2: 72,971,501 A56V possibly damaging Het
Spag17 T A 3: 100,065,554 S1361T probably benign Het
Sptbn2 A G 19: 4,737,926 T978A probably benign Het
Stom C A 2: 35,321,632 V126F probably damaging Het
Stpg2 A G 3: 139,218,321 T162A probably damaging Het
Stxbp6 G A 12: 44,902,957 T63M probably damaging Het
Tatdn1 A C 15: 58,921,350 I69S probably benign Het
Tbata A T 10: 61,180,339 D198V probably damaging Het
Tbc1d5 T C 17: 50,756,705 I638V probably benign Het
Tomm70a A G 16: 57,149,903 D548G probably benign Het
Ust A G 10: 8,245,936 F303L probably damaging Het
Vps13d A G 4: 144,976,560 S4306P probably benign Het
Zfp691 A G 4: 119,170,496 S180P possibly damaging Het
Other mutations in Prkcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Prkcg APN 7 3319619 missense probably benign 0.27
IGL01551:Prkcg APN 7 3303826 unclassified probably benign
IGL02167:Prkcg APN 7 3322581 critical splice donor site probably null
IGL02434:Prkcg APN 7 3318890 missense probably benign
R0044:Prkcg UTSW 7 3315001 intron probably benign
R0164:Prkcg UTSW 7 3329119 missense probably damaging 1.00
R0164:Prkcg UTSW 7 3329119 missense probably damaging 1.00
R0413:Prkcg UTSW 7 3319579 missense probably benign 0.00
R1113:Prkcg UTSW 7 3329106 missense probably damaging 1.00
R1170:Prkcg UTSW 7 3319661 missense probably damaging 0.97
R1308:Prkcg UTSW 7 3329106 missense probably damaging 1.00
R1634:Prkcg UTSW 7 3323470 missense probably damaging 1.00
R1978:Prkcg UTSW 7 3305346 missense probably damaging 1.00
R2016:Prkcg UTSW 7 3323550 missense probably damaging 0.98
R2209:Prkcg UTSW 7 3303581 unclassified probably benign
R3788:Prkcg UTSW 7 3313747 missense probably damaging 0.99
R4006:Prkcg UTSW 7 3327467 missense probably damaging 0.96
R4853:Prkcg UTSW 7 3318953 missense probably damaging 0.99
R4915:Prkcg UTSW 7 3330265 nonsense probably null
R4916:Prkcg UTSW 7 3330265 nonsense probably null
R4997:Prkcg UTSW 7 3322581 critical splice donor site probably null
R5446:Prkcg UTSW 7 3330264 missense probably benign 0.00
R5646:Prkcg UTSW 7 3329081 missense probably damaging 0.97
R5677:Prkcg UTSW 7 3323458 missense probably damaging 1.00
R6913:Prkcg UTSW 7 3313819 missense probably benign 0.02
R7355:Prkcg UTSW 7 3323509 missense possibly damaging 0.94
R7371:Prkcg UTSW 7 3319553 missense probably benign 0.27
R7544:Prkcg UTSW 7 3310565 missense probably benign 0.00
R7649:Prkcg UTSW 7 3329964 missense probably benign 0.09
R7742:Prkcg UTSW 7 3329943 missense possibly damaging 0.84
R8009:Prkcg UTSW 7 3314192 missense probably benign
R8074:Prkcg UTSW 7 3323521 missense probably damaging 1.00
R8296:Prkcg UTSW 7 3329064 missense probably benign 0.37
R8344:Prkcg UTSW 7 3330170 missense probably damaging 1.00
R8887:Prkcg UTSW 7 3322341 missense possibly damaging 0.94
R9343:Prkcg UTSW 7 3310608 missense possibly damaging 0.55
R9426:Prkcg UTSW 7 3327459 missense probably damaging 1.00
R9530:Prkcg UTSW 7 3327449 missense possibly damaging 0.89
R9605:Prkcg UTSW 7 3310844 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGACTTGGGAACAGTCATGTCACAC -3'
(R):5'- GGGCTCTGACTTTGCATCTCTGAAC -3'

Sequencing Primer
(F):5'- GAACAGTCATGTCACACTGGTC -3'
(R):5'- ACCACAGGCTGTGTGTCTC -3'
Posted On 2013-05-23