Incidental Mutation 'R5276:Zfp955b'
ID403976
Institutional Source Beutler Lab
Gene Symbol Zfp955b
Ensembl Gene ENSMUSG00000096910
Gene Namezinc finger protein 955B
SynonymsA430003O12Rik, C430039G02Rik, Gm4455
MMRRC Submission 042863-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5276 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33289649-33303196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33303057 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 500 (Y500C)
Ref Sequence ENSEMBL: ENSMUSP00000097011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099414]
Predicted Effect probably damaging
Transcript: ENSMUST00000099414
AA Change: Y500C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097011
Gene: ENSMUSG00000096910
AA Change: Y500C

DomainStartEndE-ValueType
KRAB 10 70 3.04e-14 SMART
ZnF_C2H2 230 252 7.68e0 SMART
ZnF_C2H2 258 280 5.72e-1 SMART
ZnF_C2H2 290 312 6.75e0 SMART
ZnF_C2H2 318 340 5.81e-2 SMART
ZnF_C2H2 346 368 3.16e-3 SMART
ZnF_C2H2 374 396 1.18e-2 SMART
ZnF_C2H2 402 424 7.78e-3 SMART
ZnF_C2H2 430 452 3.16e-3 SMART
ZnF_C2H2 458 480 1.1e-2 SMART
ZnF_C2H2 486 508 2.09e-3 SMART
ZnF_C2H2 514 536 6.67e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182230
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A G 8: 43,570,420 F11S probably benign Het
Adipor2 T A 6: 119,357,221 I343F probably damaging Het
Ahdc1 C T 4: 133,062,798 P450L possibly damaging Het
Akna A C 4: 63,368,203 V1353G possibly damaging Het
Baz2b G A 2: 59,962,614 T390I probably benign Het
Btbd7 T C 12: 102,838,392 K130E probably benign Het
Cdc42bpa A G 1: 180,137,850 Y1101C probably damaging Het
Crlf2 T G 5: 109,557,635 probably benign Het
Ddx59 A T 1: 136,419,448 R281S probably damaging Het
Dgcr8 T G 16: 18,283,771 T216P probably benign Het
Dsg4 A T 18: 20,446,839 I34F probably benign Het
Enpp3 A G 10: 24,809,916 S194P probably damaging Het
Entpd8 C T 2: 25,085,045 R463W probably benign Het
Fam169a A G 13: 97,118,496 T407A probably benign Het
Fam98b G T 2: 117,259,298 V99F possibly damaging Het
Foxn3 T A 12: 99,196,428 K405* probably null Het
Gm340 T A 19: 41,585,039 H744Q probably damaging Het
Gsdmc T C 15: 63,801,957 T160A probably benign Het
Hdac1 T C 4: 129,528,923 probably null Het
Igfbp1 A C 11: 7,201,892 T232P probably damaging Het
Mertk G C 2: 128,801,314 G878R possibly damaging Het
Metap2 G T 10: 93,868,922 P281H possibly damaging Het
Metap2 T A 10: 93,868,932 T278S probably benign Het
Mfn1 T C 3: 32,564,205 V169A probably benign Het
Mms22l A G 4: 24,578,774 D751G probably damaging Het
Mpl A G 4: 118,455,721 V138A probably benign Het
Myef2 T A 2: 125,095,721 K533N probably damaging Het
Mylk3 C T 8: 85,355,442 G309E probably damaging Het
Nid1 T C 13: 13,468,572 V365A probably damaging Het
Olfr27 T C 9: 39,144,315 C72R probably damaging Het
Olfr463 A T 11: 87,893,192 I244N probably damaging Het
Olfr480 A T 7: 108,066,216 L164* probably null Het
Olfr77 C A 9: 19,920,621 N137K possibly damaging Het
Pbrm1 A G 14: 31,106,184 K1323E probably damaging Het
Pcdhga12 G A 18: 37,766,675 D187N possibly damaging Het
Phrf1 T C 7: 141,259,283 probably benign Het
Phtf2 A G 5: 20,772,197 V608A probably benign Het
Plec G A 15: 76,173,438 R4122W probably damaging Het
Polm A G 11: 5,829,393 S441P probably benign Het
Prrc2b T A 2: 32,214,722 V1404E probably benign Het
Ptger1 T G 8: 83,669,345 S344A possibly damaging Het
Rasef A T 4: 73,735,767 D401E probably null Het
Rbfox3 T C 11: 118,496,352 Y312C probably damaging Het
Rbm48 A G 5: 3,584,759 C402R probably benign Het
Rhbdl3 G A 11: 80,319,666 A82T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sidt2 T A 9: 45,954,777 N44Y probably damaging Het
Slf2 T A 19: 44,935,161 L138Q possibly damaging Het
Spag16 T C 1: 69,896,583 probably null Het
Sspo C T 6: 48,490,467 P4188S probably damaging Het
Synm C T 7: 67,734,689 S1075N probably benign Het
Tacc2 G T 7: 130,729,317 D2151Y probably damaging Het
Tbc1d32 C A 10: 56,151,818 L729F probably damaging Het
Tnfsf4 A G 1: 161,417,013 N91S possibly damaging Het
Trim63 G A 4: 134,323,133 E243K probably benign Het
Trim72 T G 7: 128,004,542 L20R probably damaging Het
Tubb1 A G 2: 174,457,424 M300V probably damaging Het
Ubfd1 C T 7: 122,068,868 A207V probably damaging Het
Usp16 T A 16: 87,470,451 probably null Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Vmn2r72 T A 7: 85,738,254 I701F possibly damaging Het
Wdfy4 A G 14: 33,047,275 Y2078H probably damaging Het
Wdr41 T C 13: 95,017,450 probably null Het
Other mutations in Zfp955b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Zfp955b APN 17 33302873 missense probably damaging 1.00
IGL02073:Zfp955b APN 17 33300590 missense possibly damaging 0.69
IGL02126:Zfp955b APN 17 33302264 nonsense probably null
IGL02237:Zfp955b APN 17 33301919 missense probably damaging 1.00
IGL02587:Zfp955b APN 17 33300650 missense probably damaging 1.00
IGL02971:Zfp955b APN 17 33300966 missense probably benign 0.11
IGL03034:Zfp955b APN 17 33302168 missense probably benign 0.22
IGL03493:Zfp955b APN 17 33302545 missense probably benign 0.35
R0269:Zfp955b UTSW 17 33305463 missense probably damaging 1.00
R0373:Zfp955b UTSW 17 33302522 missense probably benign
R0617:Zfp955b UTSW 17 33305463 missense probably damaging 1.00
R0684:Zfp955b UTSW 17 33302973 missense probably benign 0.00
R1778:Zfp955b UTSW 17 33302814 missense probably benign 0.07
R1874:Zfp955b UTSW 17 33305453 missense probably benign 0.10
R3893:Zfp955b UTSW 17 33302994 missense probably benign 0.01
R3938:Zfp955b UTSW 17 33305416 missense probably damaging 1.00
R4082:Zfp955b UTSW 17 33302155 missense probably benign 0.08
R4672:Zfp955b UTSW 17 33305259 unclassified probably benign
R4956:Zfp955b UTSW 17 33305235 unclassified probably benign
R4998:Zfp955b UTSW 17 33305151 unclassified probably benign
R5341:Zfp955b UTSW 17 33305121 unclassified probably benign
R5558:Zfp955b UTSW 17 33302187 missense possibly damaging 0.88
R6086:Zfp955b UTSW 17 33302504 missense probably benign
R6170:Zfp955b UTSW 17 33302110 missense probably benign 0.00
R6306:Zfp955b UTSW 17 33303186 missense probably benign 0.07
R6519:Zfp955b UTSW 17 33302077 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GTGAGGGCAACTGTTCCAAC -3'
(R):5'- GTGTAAGAAGCATGCAAACACTTTC -3'

Sequencing Primer
(F):5'- ACCTACGTTTGCAAGCAGTG -3'
(R):5'- GAATTTCTCTCTAGCACTATGAGTTC -3'
Posted On2016-07-22