Incidental Mutation 'R5276:Dsg4'
ID403978
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Namedesmoglein 4
Synonymslah, CDHF13
MMRRC Submission 042863-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R5276 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20436175-20471821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20446839 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 34 (I34F)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
Predicted Effect probably benign
Transcript: ENSMUST00000019426
AA Change: I34F

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: I34F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A G 8: 43,570,420 F11S probably benign Het
Adipor2 T A 6: 119,357,221 I343F probably damaging Het
Ahdc1 C T 4: 133,062,798 P450L possibly damaging Het
Akna A C 4: 63,368,203 V1353G possibly damaging Het
Baz2b G A 2: 59,962,614 T390I probably benign Het
Btbd7 T C 12: 102,838,392 K130E probably benign Het
Cdc42bpa A G 1: 180,137,850 Y1101C probably damaging Het
Crlf2 T G 5: 109,557,635 probably benign Het
Ddx59 A T 1: 136,419,448 R281S probably damaging Het
Dgcr8 T G 16: 18,283,771 T216P probably benign Het
Enpp3 A G 10: 24,809,916 S194P probably damaging Het
Entpd8 C T 2: 25,085,045 R463W probably benign Het
Fam169a A G 13: 97,118,496 T407A probably benign Het
Fam98b G T 2: 117,259,298 V99F possibly damaging Het
Foxn3 T A 12: 99,196,428 K405* probably null Het
Gm340 T A 19: 41,585,039 H744Q probably damaging Het
Gsdmc T C 15: 63,801,957 T160A probably benign Het
Hdac1 T C 4: 129,528,923 probably null Het
Igfbp1 A C 11: 7,201,892 T232P probably damaging Het
Mertk G C 2: 128,801,314 G878R possibly damaging Het
Metap2 G T 10: 93,868,922 P281H possibly damaging Het
Metap2 T A 10: 93,868,932 T278S probably benign Het
Mfn1 T C 3: 32,564,205 V169A probably benign Het
Mms22l A G 4: 24,578,774 D751G probably damaging Het
Mpl A G 4: 118,455,721 V138A probably benign Het
Myef2 T A 2: 125,095,721 K533N probably damaging Het
Mylk3 C T 8: 85,355,442 G309E probably damaging Het
Nid1 T C 13: 13,468,572 V365A probably damaging Het
Olfr27 T C 9: 39,144,315 C72R probably damaging Het
Olfr463 A T 11: 87,893,192 I244N probably damaging Het
Olfr480 A T 7: 108,066,216 L164* probably null Het
Olfr77 C A 9: 19,920,621 N137K possibly damaging Het
Pbrm1 A G 14: 31,106,184 K1323E probably damaging Het
Pcdhga12 G A 18: 37,766,675 D187N possibly damaging Het
Phrf1 T C 7: 141,259,283 probably benign Het
Phtf2 A G 5: 20,772,197 V608A probably benign Het
Plec G A 15: 76,173,438 R4122W probably damaging Het
Polm A G 11: 5,829,393 S441P probably benign Het
Prrc2b T A 2: 32,214,722 V1404E probably benign Het
Ptger1 T G 8: 83,669,345 S344A possibly damaging Het
Rasef A T 4: 73,735,767 D401E probably null Het
Rbfox3 T C 11: 118,496,352 Y312C probably damaging Het
Rbm48 A G 5: 3,584,759 C402R probably benign Het
Rhbdl3 G A 11: 80,319,666 A82T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sidt2 T A 9: 45,954,777 N44Y probably damaging Het
Slf2 T A 19: 44,935,161 L138Q possibly damaging Het
Spag16 T C 1: 69,896,583 probably null Het
Sspo C T 6: 48,490,467 P4188S probably damaging Het
Synm C T 7: 67,734,689 S1075N probably benign Het
Tacc2 G T 7: 130,729,317 D2151Y probably damaging Het
Tbc1d32 C A 10: 56,151,818 L729F probably damaging Het
Tnfsf4 A G 1: 161,417,013 N91S possibly damaging Het
Trim63 G A 4: 134,323,133 E243K probably benign Het
Trim72 T G 7: 128,004,542 L20R probably damaging Het
Tubb1 A G 2: 174,457,424 M300V probably damaging Het
Ubfd1 C T 7: 122,068,868 A207V probably damaging Het
Usp16 T A 16: 87,470,451 probably null Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Vmn2r72 T A 7: 85,738,254 I701F possibly damaging Het
Wdfy4 A G 14: 33,047,275 Y2078H probably damaging Het
Wdr41 T C 13: 95,017,450 probably null Het
Zfp955b A G 17: 33,303,057 Y500C probably damaging Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5426:Dsg4 UTSW 18 20458484 missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R5982:Dsg4 UTSW 18 20465169 missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20471363 missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20451936 intron probably null
R7612:Dsg4 UTSW 18 20470990 missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20449712 missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
R7988:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCCAACACAGTTAGGGG -3'
(R):5'- CTGAAGGCTGCAAGTCCTTGAG -3'

Sequencing Primer
(F):5'- CCCAACACAGTTAGGGGTGGAG -3'
(R):5'- GAAGGCTGCAAGTCCTTGAGATATTC -3'
Posted On2016-07-22