Incidental Mutation 'R5277:Nckap5'
ID403983
Institutional Source Beutler Lab
Gene Symbol Nckap5
Ensembl Gene ENSMUSG00000049690
Gene NameNCK-associated protein 5
SynonymsE030049G20Rik, LOC380609, D130011D22Rik
MMRRC Submission 042864-MU
Accession Numbers

Genbank: NM_001081756, NM_172484, NM_176957

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5277 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location125913620-126830799 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 126026540 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 758 (C758*)
Ref Sequence ENSEMBL: ENSMUSP00000125624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057846] [ENSMUST00000094609] [ENSMUST00000094610] [ENSMUST00000112583] [ENSMUST00000161954] [ENSMUST00000162877]
Predicted Effect probably null
Transcript: ENSMUST00000057846
AA Change: C694*
SMART Domains Protein: ENSMUSP00000062229
Gene: ENSMUSG00000049690
AA Change: C694*

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 950 971 N/A INTRINSIC
low complexity region 1070 1085 N/A INTRINSIC
low complexity region 1181 1200 N/A INTRINSIC
Pfam:NCKAP5 1298 1602 1.8e-120 PFAM
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1757 1771 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094609
SMART Domains Protein: ENSMUSP00000092192
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
Pfam:NCKAP5 113 364 3.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094610
SMART Domains Protein: ENSMUSP00000092193
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 1 101 8.8e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112583
AA Change: C826*
SMART Domains Protein: ENSMUSP00000108202
Gene: ENSMUSG00000049690
AA Change: C826*

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
coiled coil region 176 254 N/A INTRINSIC
low complexity region 301 324 N/A INTRINSIC
low complexity region 453 464 N/A INTRINSIC
low complexity region 887 903 N/A INTRINSIC
low complexity region 1082 1103 N/A INTRINSIC
low complexity region 1202 1217 N/A INTRINSIC
low complexity region 1313 1332 N/A INTRINSIC
Pfam:NCKAP5 1431 1733 5.3e-119 PFAM
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1889 1903 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159934
Predicted Effect probably null
Transcript: ENSMUST00000161954
AA Change: C758*
SMART Domains Protein: ENSMUSP00000125624
Gene: ENSMUSG00000049690
AA Change: C758*

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 233 256 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
low complexity region 1014 1035 N/A INTRINSIC
low complexity region 1134 1149 N/A INTRINSIC
low complexity region 1245 1264 N/A INTRINSIC
Pfam:NCKAP5 1362 1666 2.1e-120 PFAM
low complexity region 1792 1806 N/A INTRINSIC
low complexity region 1821 1835 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162877
SMART Domains Protein: ENSMUSP00000124748
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 9 296 6e-36 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Nckap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nckap5 APN 1 126027152 missense probably damaging 0.99
IGL00956:Nckap5 APN 1 126025018 missense probably damaging 0.98
IGL01414:Nckap5 APN 1 126528713 missense probably damaging 1.00
IGL01482:Nckap5 APN 1 126023160 missense probably damaging 1.00
IGL01508:Nckap5 APN 1 126025572 missense probably damaging 0.96
IGL02071:Nckap5 APN 1 125981568 missense probably damaging 0.97
IGL02129:Nckap5 APN 1 126027695 nonsense probably null
IGL02821:Nckap5 APN 1 126027816 missense probably damaging 1.00
IGL03174:Nckap5 APN 1 125981646 missense probably damaging 1.00
F5493:Nckap5 UTSW 1 126025827 missense probably benign
G5030:Nckap5 UTSW 1 126025854 missense probably damaging 0.96
R0033:Nckap5 UTSW 1 125940242 intron probably benign
R0164:Nckap5 UTSW 1 126024407 missense possibly damaging 0.84
R0164:Nckap5 UTSW 1 126024407 missense possibly damaging 0.84
R0349:Nckap5 UTSW 1 126026434 missense probably benign
R0482:Nckap5 UTSW 1 126026365 missense possibly damaging 0.92
R0508:Nckap5 UTSW 1 125981384 splice site probably null
R0541:Nckap5 UTSW 1 126695722 missense possibly damaging 0.82
R0609:Nckap5 UTSW 1 126027288 nonsense probably null
R0701:Nckap5 UTSW 1 126025357 missense probably benign 0.06
R0782:Nckap5 UTSW 1 125981541 missense probably damaging 1.00
R1389:Nckap5 UTSW 1 126026710 missense probably damaging 0.99
R1401:Nckap5 UTSW 1 126014661 splice site probably benign
R1436:Nckap5 UTSW 1 126026061 missense possibly damaging 0.96
R1506:Nckap5 UTSW 1 126025913 nonsense probably null
R1528:Nckap5 UTSW 1 126024922 missense possibly damaging 0.68
R1942:Nckap5 UTSW 1 126024302 missense probably damaging 1.00
R1968:Nckap5 UTSW 1 126014630 missense probably damaging 0.99
R2055:Nckap5 UTSW 1 126026898 missense probably damaging 1.00
R2105:Nckap5 UTSW 1 126026518 missense probably damaging 1.00
R2214:Nckap5 UTSW 1 126025750 missense possibly damaging 0.77
R2311:Nckap5 UTSW 1 126528752 missense probably damaging 1.00
R2403:Nckap5 UTSW 1 126027409 missense probably benign 0.18
R2430:Nckap5 UTSW 1 125914757 missense probably damaging 0.99
R2914:Nckap5 UTSW 1 126026537 splice site probably null
R3782:Nckap5 UTSW 1 126025074 missense possibly damaging 0.93
R4133:Nckap5 UTSW 1 126222706 missense probably benign 0.13
R4249:Nckap5 UTSW 1 126027639 missense probably benign 0.01
R4448:Nckap5 UTSW 1 126025726 nonsense probably null
R4456:Nckap5 UTSW 1 125914735 unclassified probably benign
R4682:Nckap5 UTSW 1 126102542 critical splice donor site probably null
R4817:Nckap5 UTSW 1 126027215 missense possibly damaging 0.68
R4907:Nckap5 UTSW 1 126026152 missense possibly damaging 0.92
R4908:Nckap5 UTSW 1 126027587 missense probably damaging 1.00
R4924:Nckap5 UTSW 1 126027028 nonsense probably null
R4926:Nckap5 UTSW 1 126528641 intron probably benign
R5032:Nckap5 UTSW 1 125977049 missense possibly damaging 0.62
R5133:Nckap5 UTSW 1 126033960 missense probably benign 0.01
R5197:Nckap5 UTSW 1 126222673 missense possibly damaging 0.79
R5238:Nckap5 UTSW 1 126027724 missense probably damaging 0.96
R5257:Nckap5 UTSW 1 126024508 missense probably damaging 0.99
R5512:Nckap5 UTSW 1 126027744 missense possibly damaging 0.63
R5700:Nckap5 UTSW 1 125976925 critical splice donor site probably null
R5789:Nckap5 UTSW 1 126027702 missense probably damaging 1.00
R6029:Nckap5 UTSW 1 126025786 missense possibly damaging 0.89
R6249:Nckap5 UTSW 1 126024930 missense probably benign
R6292:Nckap5 UTSW 1 125915015 missense probably damaging 0.99
R6521:Nckap5 UTSW 1 126382172 missense probably damaging 1.00
R6875:Nckap5 UTSW 1 126023194 missense probably benign 0.03
R7017:Nckap5 UTSW 1 126102661 missense probably damaging 1.00
R7018:Nckap5 UTSW 1 126025048 missense probably damaging 0.99
R7054:Nckap5 UTSW 1 126258712 splice site probably null
R7204:Nckap5 UTSW 1 126026367 missense probably benign
R7336:Nckap5 UTSW 1 126026049 missense probably benign 0.00
R7544:Nckap5 UTSW 1 126026211 missense possibly damaging 0.92
R7590:Nckap5 UTSW 1 126026533 missense probably benign 0.00
R7684:Nckap5 UTSW 1 126026857 missense probably benign 0.00
R7749:Nckap5 UTSW 1 126024646 missense probably damaging 1.00
R7773:Nckap5 UTSW 1 126026844 missense probably benign 0.00
R7813:Nckap5 UTSW 1 126025426 missense probably benign 0.10
R7970:Nckap5 UTSW 1 126025021 nonsense probably null
R7992:Nckap5 UTSW 1 126026810 missense probably damaging 0.99
R8278:Nckap5 UTSW 1 126027772 missense probably damaging 1.00
R8373:Nckap5 UTSW 1 126026295 missense probably benign 0.02
R8414:Nckap5 UTSW 1 126014620 missense probably damaging 1.00
Z1088:Nckap5 UTSW 1 126024832 missense possibly damaging 0.76
Z1176:Nckap5 UTSW 1 126528681 critical splice donor site probably null
Z1177:Nckap5 UTSW 1 126222659 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGACCTCATTCTTGTCTGTGG -3'
(R):5'- ACATGGGTGTCTACACAAAGC -3'

Sequencing Primer
(F):5'- GCGCAGAGACACAGCCATTG -3'
(R):5'- TGTCTACACAAAGCAAGGTCTG -3'
Posted On2016-07-22