Incidental Mutation 'R5277:Dcaf6'
ID403985
Institutional Source Beutler Lab
Gene Symbol Dcaf6
Ensembl Gene ENSMUSG00000026571
Gene NameDDB1 and CUL4 associated factor 6
SynonymsPC326, 1200006M05Rik, Iqwd1
MMRRC Submission 042864-MU
Accession Numbers

Genbank: NM_028759; MGI: 1921356

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5277 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location165328698-165460475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 165424346 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 70 (S70P)
Ref Sequence ENSEMBL: ENSMUSP00000027856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027856]
Predicted Effect probably benign
Transcript: ENSMUST00000027856
AA Change: S70P

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027856
Gene: ENSMUSG00000026571
AA Change: S70P

DomainStartEndE-ValueType
WD40 40 79 5.77e-5 SMART
WD40 82 124 1.2e-2 SMART
WD40 130 170 2.15e-1 SMART
WD40 184 220 3.33e-1 SMART
WD40 238 281 6.66e-1 SMART
low complexity region 364 374 N/A INTRINSIC
low complexity region 499 510 N/A INTRINSIC
low complexity region 669 676 N/A INTRINSIC
IQ 691 713 1.25e1 SMART
WD40 722 763 3.84e0 SMART
WD40 766 805 1.22e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195686
Meta Mutation Damage Score 0.8674 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Dcaf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00828:Dcaf6 APN 1 165338347 splice site probably benign
IGL01377:Dcaf6 APN 1 165388724 missense probably benign 0.01
IGL02027:Dcaf6 APN 1 165424341 missense probably damaging 1.00
IGL02390:Dcaf6 APN 1 165422921 missense possibly damaging 0.50
IGL02754:Dcaf6 APN 1 165338346 critical splice acceptor site probably null
IGL02900:Dcaf6 APN 1 165399775 missense probably damaging 1.00
IGL03119:Dcaf6 APN 1 165339976 missense probably damaging 1.00
IGL03211:Dcaf6 APN 1 165422933 missense possibly damaging 0.55
R0588:Dcaf6 UTSW 1 165420223 missense possibly damaging 0.89
R1494:Dcaf6 UTSW 1 165333373 missense probably damaging 0.99
R1512:Dcaf6 UTSW 1 165352020 missense probably benign 0.22
R1840:Dcaf6 UTSW 1 165399748 missense probably damaging 0.96
R2191:Dcaf6 UTSW 1 165422864 missense probably benign 0.07
R2297:Dcaf6 UTSW 1 165399862 missense probably damaging 1.00
R3082:Dcaf6 UTSW 1 165422852 splice site probably benign
R3861:Dcaf6 UTSW 1 165429269 missense probably damaging 1.00
R3907:Dcaf6 UTSW 1 165424380 nonsense probably null
R4521:Dcaf6 UTSW 1 165390490 missense probably damaging 0.98
R4531:Dcaf6 UTSW 1 165411467 missense probably damaging 1.00
R4906:Dcaf6 UTSW 1 165411463 critical splice donor site probably null
R4916:Dcaf6 UTSW 1 165420205 missense probably damaging 1.00
R4956:Dcaf6 UTSW 1 165388785 missense probably benign 0.00
R5080:Dcaf6 UTSW 1 165420121 missense probably damaging 1.00
R5091:Dcaf6 UTSW 1 165330003 missense possibly damaging 0.76
R5512:Dcaf6 UTSW 1 165399835 missense possibly damaging 0.84
R5914:Dcaf6 UTSW 1 165351155 missense probably benign
R6004:Dcaf6 UTSW 1 165388685 missense probably benign 0.00
R6239:Dcaf6 UTSW 1 165351270 missense possibly damaging 0.47
R6736:Dcaf6 UTSW 1 165399785 missense possibly damaging 0.77
R7051:Dcaf6 UTSW 1 165424317 missense possibly damaging 0.82
R7110:Dcaf6 UTSW 1 165351968 missense probably benign 0.22
R7583:Dcaf6 UTSW 1 165333310 missense probably damaging 1.00
R7776:Dcaf6 UTSW 1 165352054 nonsense probably null
R7790:Dcaf6 UTSW 1 165399715 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGAAACTGTGGTACCTACATGTG -3'
(R):5'- TGAGAACTGAAGTCTGGTTTCAAC -3'

Sequencing Primer
(F):5'- CTGTGGTACCTACATGTGACAATGTC -3'
(R):5'- AGTGAAAGACGGCTTACT -3'
Posted On2016-07-22