Incidental Mutation 'R5277:Abi1'
ID403987
Institutional Source Beutler Lab
Gene Symbol Abi1
Ensembl Gene ENSMUSG00000058835
Gene Nameabl-interactor 1
SynonymsE3B1, Ssh3bp1
MMRRC Submission 042864-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.760) question?
Stock #R5277 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location22940073-23040241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22994648 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 54 (T54A)
Ref Sequence ENSEMBL: ENSMUSP00000088957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078977] [ENSMUST00000091394] [ENSMUST00000093171] [ENSMUST00000114544] [ENSMUST00000123948] [ENSMUST00000126112] [ENSMUST00000139038] [ENSMUST00000140164] [ENSMUST00000149719] [ENSMUST00000153931] [ENSMUST00000178908]
Predicted Effect probably damaging
Transcript: ENSMUST00000078977
AA Change: T54A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077997
Gene: ENSMUSG00000058835
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.7e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 282 N/A INTRINSIC
low complexity region 296 303 N/A INTRINSIC
low complexity region 337 364 N/A INTRINSIC
SH3 393 448 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091394
AA Change: T54A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088957
Gene: ENSMUSG00000058835
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 4.1e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 281 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
low complexity region 336 351 N/A INTRINSIC
low complexity region 365 392 N/A INTRINSIC
SH3 421 476 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093171
AA Change: T54A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090860
Gene: ENSMUSG00000058835
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.7e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 281 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
low complexity region 336 363 N/A INTRINSIC
SH3 392 447 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114544
AA Change: T54A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110191
Gene: ENSMUSG00000058835
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 4.4e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 268 300 N/A INTRINSIC
SH3 329 384 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123948
AA Change: T54A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118491
Gene: ENSMUSG00000058835
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 5.1e-39 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 282 N/A INTRINSIC
low complexity region 296 303 N/A INTRINSIC
low complexity region 337 352 N/A INTRINSIC
low complexity region 366 393 N/A INTRINSIC
SH3 422 477 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126112
AA Change: T54A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117335
Gene: ENSMUSG00000058835
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 8.6e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 291 298 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
low complexity region 361 388 N/A INTRINSIC
SH3 417 472 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139038
AA Change: T54A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116093
Gene: ENSMUSG00000058835
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.4e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
low complexity region 307 334 N/A INTRINSIC
SH3 363 418 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140164
AA Change: T54A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120462
Gene: ENSMUSG00000058835
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 8.6e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 290 297 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 360 387 N/A INTRINSIC
SH3 416 471 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149719
AA Change: T54A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120621
Gene: ENSMUSG00000058835
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 7.8e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 290 297 N/A INTRINSIC
low complexity region 331 358 N/A INTRINSIC
SH3 387 442 2.38e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153931
AA Change: T54A

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120769
Gene: ENSMUSG00000058835
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 273 305 N/A INTRINSIC
SH3 334 389 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178908
AA Change: T54A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136846
Gene: ENSMUSG00000058835
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.9e-37 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 282 N/A INTRINSIC
low complexity region 296 303 N/A INTRINSIC
low complexity region 337 352 N/A INTRINSIC
low complexity region 366 393 N/A INTRINSIC
SH3 422 477 2.38e-23 SMART
Meta Mutation Damage Score 0.1580 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Abelson-interactor family of adaptor proteins. These proteins facilitate signal transduction as components of several multiprotein complexes, and regulate actin polymerization and cytoskeletal remodeling through interactions with Abelson tyrosine kinases. The encoded protein plays a role in macropinocytosis as a component of the WAVE2 complex, and also forms a complex with EPS8 and SOS1 that mediates signal transduction from Ras to Rac. This gene may play a role in the progression of several malignancies including melanoma, colon cancer and breast cancer, and a t(10;11) chromosomal translocation involving this gene and the MLL gene has been associated with acute myeloid leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 14. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit background sensitive embryonic lethality prior during organogenesis associated with about abnormal vasculogenesis and angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Abi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Abi1 APN 2 22941930 missense possibly damaging 0.71
IGL01694:Abi1 APN 2 22960713 missense probably damaging 1.00
IGL01809:Abi1 APN 2 22946717 missense probably benign 0.00
IGL02189:Abi1 APN 2 23040064 start codon destroyed probably null 1.00
IGL03126:Abi1 APN 2 22953467 missense probably benign 0.12
IGL03213:Abi1 APN 2 22941959 missense probably damaging 1.00
IGL03325:Abi1 APN 2 22971228 missense probably damaging 1.00
R0421:Abi1 UTSW 2 22960827 missense probably damaging 1.00
R0505:Abi1 UTSW 2 22962504 splice site probably benign
R1265:Abi1 UTSW 2 22946722 missense possibly damaging 0.85
R1851:Abi1 UTSW 2 22950264 missense possibly damaging 0.78
R2975:Abi1 UTSW 2 22957087 missense probably damaging 0.99
R3416:Abi1 UTSW 2 23040002 missense probably damaging 1.00
R5000:Abi1 UTSW 2 22950199 missense probably damaging 1.00
R5945:Abi1 UTSW 2 23039965 missense probably damaging 1.00
R6785:Abi1 UTSW 2 22953467 missense probably benign 0.12
R7000:Abi1 UTSW 2 22942041 missense probably damaging 1.00
R7249:Abi1 UTSW 2 22957089 missense possibly damaging 0.82
R7565:Abi1 UTSW 2 22946584 missense probably benign 0.00
X0026:Abi1 UTSW 2 22971154 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACTATGCTTAAGACACATGCTGC -3'
(R):5'- CCCAAGAATCATCGGATTAGTTCC -3'

Sequencing Primer
(F):5'- GCTTAAGACACATGCTGCTATTTGAC -3'
(R):5'- GCTGTAGAGCTCCATTAAACATGG -3'
Posted On2016-07-22