Incidental Mutation 'R5277:Gm14325'
ID403989
Institutional Source Beutler Lab
Gene Symbol Gm14325
Ensembl Gene ENSMUSG00000095362
Gene Namepredicted gene 14325
Synonyms
MMRRC Submission 042864-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R5277 (G1)
Quality Score146
Status Not validated
Chromosome2
Chromosomal Location177831791-177840336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 177832984 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 102 (H102Y)
Ref Sequence ENSEMBL: ENSMUSP00000104567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108939] [ENSMUST00000150650] [ENSMUST00000188914]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108939
AA Change: H102Y

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104567
Gene: ENSMUSG00000095362
AA Change: H102Y

DomainStartEndE-ValueType
KRAB 4 64 3.43e-13 SMART
ZnF_C2H2 78 97 1.61e2 SMART
ZnF_C2H2 103 125 4.17e-3 SMART
ZnF_C2H2 131 153 3.34e-2 SMART
ZnF_C2H2 159 181 5.29e-5 SMART
ZnF_C2H2 187 209 6.08e-5 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 243 265 8.02e-5 SMART
ZnF_C2H2 271 293 3.83e-2 SMART
ZnF_C2H2 299 321 5.14e-3 SMART
ZnF_C2H2 327 349 5.14e-3 SMART
ZnF_C2H2 355 377 5.99e-4 SMART
ZnF_C2H2 383 405 1.69e-3 SMART
ZnF_C2H2 411 433 7.37e-4 SMART
ZnF_C2H2 439 461 4.94e-5 SMART
ZnF_C2H2 467 489 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150650
SMART Domains Protein: ENSMUSP00000118192
Gene: ENSMUSG00000095362

DomainStartEndE-ValueType
KRAB 4 64 3.43e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188914
AA Change: H101Y

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140685
Gene: ENSMUSG00000095362
AA Change: H101Y

DomainStartEndE-ValueType
KRAB 3 63 1.4e-15 SMART
ZnF_C2H2 77 96 6.8e-1 SMART
ZnF_C2H2 102 124 1.8e-5 SMART
ZnF_C2H2 130 152 1.4e-4 SMART
ZnF_C2H2 158 180 2.3e-7 SMART
ZnF_C2H2 186 208 2.5e-7 SMART
ZnF_C2H2 214 236 2.5e-6 SMART
ZnF_C2H2 242 264 3.3e-7 SMART
ZnF_C2H2 270 292 1.6e-4 SMART
ZnF_C2H2 298 320 2.1e-5 SMART
ZnF_C2H2 326 348 2.1e-5 SMART
ZnF_C2H2 354 376 2.5e-6 SMART
ZnF_C2H2 382 404 7.3e-6 SMART
ZnF_C2H2 410 432 3.1e-6 SMART
ZnF_C2H2 438 460 2e-7 SMART
ZnF_C2H2 466 488 4.6e-6 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Gm14325
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02130:Gm14325 APN 2 177834652 unclassified probably benign
IGL02731:Gm14325 APN 2 177832986 missense probably damaging 1.00
IGL02988:Gm14325 APN 2 177834249 critical splice donor site probably null
R4490:Gm14325 UTSW 2 177832983 missense possibly damaging 0.95
R5274:Gm14325 UTSW 2 177832984 missense possibly damaging 0.92
R5295:Gm14325 UTSW 2 177832984 missense possibly damaging 0.92
R5394:Gm14325 UTSW 2 177832984 missense possibly damaging 0.92
R5395:Gm14325 UTSW 2 177832984 missense possibly damaging 0.92
R6147:Gm14325 UTSW 2 177832807 missense probably damaging 1.00
R6855:Gm14325 UTSW 2 177832842 missense probably damaging 1.00
R7198:Gm14325 UTSW 2 177832005 missense probably benign 0.02
R7221:Gm14325 UTSW 2 177834610 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTGTGAAAAGGCTTTACCACAT -3'
(R):5'- AGATTGCTCTGTTCAATGAAACCAAA -3'

Sequencing Primer
(F):5'- TGGAGTTCACCACTGCTTACAAAG -3'
(R):5'- GAAGTTGTTCTGCAGAGC -3'
Posted On2016-07-22