Incidental Mutation 'R5277:Tmem69'
ID403992
Institutional Source Beutler Lab
Gene Symbol Tmem69
Ensembl Gene ENSMUSG00000055900
Gene Nametransmembrane protein 69
SynonymsA630048M13Rik
MMRRC Submission 042864-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5277 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116551633-116555936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116553261 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 171 (F171L)
Ref Sequence ENSEMBL: ENSMUSP00000102087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030460] [ENSMUST00000069674] [ENSMUST00000106475] [ENSMUST00000106478]
Predicted Effect probably benign
Transcript: ENSMUST00000030460
SMART Domains Protein: ENSMUSP00000030460
Gene: ENSMUSG00000034042

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 376 470 5.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069674
AA Change: F171L

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000065821
Gene: ENSMUSG00000055900
AA Change: F171L

DomainStartEndE-ValueType
Pfam:DUF3429 91 232 1.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106475
SMART Domains Protein: ENSMUSP00000102083
Gene: ENSMUSG00000034042

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 377 470 1.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106478
AA Change: F171L

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102087
Gene: ENSMUSG00000055900
AA Change: F171L

DomainStartEndE-ValueType
Pfam:DUF3429 93 231 3.9e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138426
Meta Mutation Damage Score 0.1121 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Tmem69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Tmem69 APN 4 116553474 missense probably benign 0.00
IGL02893:Tmem69 APN 4 116553729 missense probably benign
R0551:Tmem69 UTSW 4 116553273 missense probably benign 0.11
R2656:Tmem69 UTSW 4 116553590 missense probably damaging 1.00
R4393:Tmem69 UTSW 4 116554767 critical splice donor site probably null
R4632:Tmem69 UTSW 4 116553038 missense probably benign
R5559:Tmem69 UTSW 4 116553191 missense probably damaging 1.00
R6053:Tmem69 UTSW 4 116553384 missense possibly damaging 0.75
R6954:Tmem69 UTSW 4 116554724 intron probably null
R7403:Tmem69 UTSW 4 116553467 missense probably damaging 1.00
R7778:Tmem69 UTSW 4 116553398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAATCGGGTCTCTTGGGCC -3'
(R):5'- ATAACTCTGGCGGGGTTAATCC -3'

Sequencing Primer
(F):5'- GGCCCTTTTTCTGGATAAATATTTTC -3'
(R):5'- TCCCCCACTTCTCATGGTAATAAC -3'
Posted On2016-07-22