Incidental Mutation 'R5277:Vwde'
ID403996
Institutional Source Beutler Lab
Gene Symbol Vwde
Ensembl Gene ENSMUSG00000079679
Gene Namevon Willebrand factor D and EGF domains
SynonymsLOC232585
MMRRC Submission 042864-MU
Accession Numbers

Genbank: NM_001013757; MGI: 2685313 

Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R5277 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location13156299-13224965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13186996 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 831 (T831A)
Ref Sequence ENSEMBL: ENSMUSP00000058110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054530] [ENSMUST00000203074]
Predicted Effect probably benign
Transcript: ENSMUST00000054530
AA Change: T831A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000058110
Gene: ENSMUSG00000079679
AA Change: T831A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:ZP 58 163 1e-5 BLAST
low complexity region 192 199 N/A INTRINSIC
VWD 420 588 1.51e-4 SMART
low complexity region 638 651 N/A INTRINSIC
Blast:EGF_like 890 918 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000203074
AA Change: T831A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000145311
Gene: ENSMUSG00000079679
AA Change: T831A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 192 199 N/A INTRINSIC
VWD 420 588 7.4e-7 SMART
low complexity region 638 651 N/A INTRINSIC
EGF_like 890 918 1.5e-1 SMART
EGF 1166 1217 8.5e-6 SMART
EGF_like 1182 1233 2.7e-2 SMART
EGF 1222 1254 9.7e-7 SMART
EGF_CA 1256 1295 5.3e-12 SMART
EGF 1446 1483 5e-2 SMART
EGF 1485 1514 3.8e-3 SMART
EGF 1517 1546 3.6e-3 SMART
EGF 1549 1578 8e-7 SMART
EGF 1581 1610 3.4e-3 SMART
EGF 1613 1642 1.5e-3 SMART
EGF 1645 1674 1.1e-5 SMART
EGF 1677 1706 2.5e-4 SMART
EGF 1709 1738 2.5e-3 SMART
EGF 1741 1770 1.8e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Vwde
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Vwde APN 6 13187412 missense probably benign 0.00
IGL01391:Vwde APN 6 13190527 missense probably benign 0.07
IGL01432:Vwde APN 6 13193240 missense probably benign 0.18
IGL01611:Vwde APN 6 13219978 missense probably damaging 1.00
IGL01835:Vwde APN 6 13186824 missense probably benign 0.43
IGL01993:Vwde APN 6 13219978 missense possibly damaging 0.89
IGL01997:Vwde APN 6 13215706 missense probably damaging 1.00
IGL02390:Vwde APN 6 13190685 missense probably damaging 1.00
IGL02612:Vwde APN 6 13187149 missense probably damaging 1.00
IGL02723:Vwde APN 6 13205760 missense probably damaging 0.99
IGL02731:Vwde APN 6 13192614 missense probably damaging 1.00
IGL02869:Vwde APN 6 13187137 missense probably damaging 1.00
IGL02981:Vwde APN 6 13193113 missense possibly damaging 0.84
IGL03031:Vwde APN 6 13208382 missense probably benign 0.10
IGL03180:Vwde APN 6 13205765 missense probably damaging 1.00
IGL03182:Vwde APN 6 13187139 missense probably damaging 1.00
willy_brandt UTSW 6 13208405 splice site probably null
C9142:Vwde UTSW 6 13168054 splice site probably benign
R0089:Vwde UTSW 6 13220005 missense probably damaging 1.00
R0244:Vwde UTSW 6 13193126 missense probably benign 0.16
R0355:Vwde UTSW 6 13187807 splice site probably benign
R0455:Vwde UTSW 6 13187529 missense probably benign 0.03
R0465:Vwde UTSW 6 13215806 splice site probably benign
R0946:Vwde UTSW 6 13187875 missense probably damaging 1.00
R1087:Vwde UTSW 6 13186804 missense probably damaging 1.00
R1236:Vwde UTSW 6 13187153 nonsense probably null
R1738:Vwde UTSW 6 13190724 missense probably damaging 1.00
R1891:Vwde UTSW 6 13187455 missense probably damaging 0.98
R2014:Vwde UTSW 6 13208338 missense possibly damaging 0.91
R2015:Vwde UTSW 6 13208338 missense possibly damaging 0.91
R2303:Vwde UTSW 6 13215807 splice site probably benign
R3439:Vwde UTSW 6 13208375 missense probably damaging 0.98
R3688:Vwde UTSW 6 13186892 missense probably damaging 0.96
R4457:Vwde UTSW 6 13196101 missense probably damaging 1.00
R4755:Vwde UTSW 6 13205852 missense possibly damaging 0.94
R4849:Vwde UTSW 6 13196048 missense possibly damaging 0.92
R4850:Vwde UTSW 6 13196048 missense possibly damaging 0.92
R4851:Vwde UTSW 6 13196048 missense possibly damaging 0.92
R4853:Vwde UTSW 6 13215640 missense probably damaging 1.00
R4951:Vwde UTSW 6 13187139 missense probably damaging 1.00
R5023:Vwde UTSW 6 13192642 missense possibly damaging 0.48
R5057:Vwde UTSW 6 13192642 missense possibly damaging 0.48
R5060:Vwde UTSW 6 13208324 splice site probably null
R5126:Vwde UTSW 6 13187260 missense probably benign 0.04
R5154:Vwde UTSW 6 13215758 missense probably benign 0.01
R5432:Vwde UTSW 6 13190592 missense probably damaging 1.00
R5436:Vwde UTSW 6 13190628 missense probably damaging 1.00
R5472:Vwde UTSW 6 13193118 missense probably benign 0.00
R5518:Vwde UTSW 6 13186938 missense probably benign 0.00
R5791:Vwde UTSW 6 13195986 nonsense probably null
R6045:Vwde UTSW 6 13219936 missense probably damaging 1.00
R6262:Vwde UTSW 6 13205021 missense probably damaging 1.00
R6482:Vwde UTSW 6 13205844 missense probably damaging 1.00
R6500:Vwde UTSW 6 13208405 splice site probably null
R6562:Vwde UTSW 6 13193123 missense possibly damaging 0.84
R6905:Vwde UTSW 6 13205927 missense probably damaging 1.00
R7021:Vwde UTSW 6 13186906 missense probably damaging 1.00
R7103:Vwde UTSW 6 13215800 missense probably benign 0.03
R7356:Vwde UTSW 6 13192642 missense probably damaging 0.96
R7434:Vwde UTSW 6 13187640 missense probably benign 0.00
R7492:Vwde UTSW 6 13204981 missense probably null 1.00
R8026:Vwde UTSW 6 13205783 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGTCCACTGCATAAATTGGGAC -3'
(R):5'- TCCAGAGTCTTGGACAAGGC -3'

Sequencing Primer
(F):5'- GGACATTTTAACACTTCCAGAATGCC -3'
(R):5'- TCTTGGACAAGGCAACCTG -3'
Posted On2016-07-22