Incidental Mutation 'R5277:Vmn2r75'
ID404000
Institutional Source Beutler Lab
Gene Symbol Vmn2r75
Ensembl Gene ENSMUSG00000090436
Gene Namevomeronasal 2, receptor 75
SynonymsEG546981
MMRRC Submission 042864-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5277 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86148042-86171724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86166292 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 121 (S121R)
Ref Sequence ENSEMBL: ENSMUSP00000126973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167830]
Predicted Effect probably benign
Transcript: ENSMUST00000167830
AA Change: S121R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126973
Gene: ENSMUSG00000090436
AA Change: S121R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 80 466 2.8e-31 PFAM
Pfam:NCD3G 510 562 4.6e-20 PFAM
Pfam:7tm_3 593 829 7.7e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Vmn2r75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Vmn2r75 APN 7 86148032 unclassified probably benign
IGL01287:Vmn2r75 APN 7 86148593 missense probably damaging 0.97
IGL01318:Vmn2r75 APN 7 86165566 missense probably benign 0.06
IGL01331:Vmn2r75 APN 7 86171662 nonsense probably null
IGL01406:Vmn2r75 APN 7 86163292 splice site probably benign
IGL01615:Vmn2r75 APN 7 86148473 missense probably benign 0.03
IGL01657:Vmn2r75 APN 7 86164247 missense probably damaging 1.00
IGL02237:Vmn2r75 APN 7 86165578 missense possibly damaging 0.88
IGL02275:Vmn2r75 APN 7 86165140 missense probably benign 0.04
IGL02307:Vmn2r75 APN 7 86165766 missense probably benign 0.00
IGL03136:Vmn2r75 APN 7 86148703 missense possibly damaging 0.89
IGL03160:Vmn2r75 APN 7 86148436 missense probably damaging 1.00
IGL03244:Vmn2r75 APN 7 86171725 unclassified probably benign
PIT4449001:Vmn2r75 UTSW 7 86165583 missense probably damaging 1.00
R0049:Vmn2r75 UTSW 7 86148101 nonsense probably null
R0049:Vmn2r75 UTSW 7 86148101 nonsense probably null
R0083:Vmn2r75 UTSW 7 86165658 missense probably benign 0.00
R0108:Vmn2r75 UTSW 7 86165658 missense probably benign 0.00
R0276:Vmn2r75 UTSW 7 86148307 missense probably benign 0.01
R0320:Vmn2r75 UTSW 7 86165080 missense probably benign 0.36
R0471:Vmn2r75 UTSW 7 86165513 missense probably benign 0.01
R0562:Vmn2r75 UTSW 7 86148241 nonsense probably null
R0631:Vmn2r75 UTSW 7 86163270 missense probably null 1.00
R0661:Vmn2r75 UTSW 7 86165658 missense probably benign 0.00
R0811:Vmn2r75 UTSW 7 86165367 missense probably benign 0.38
R0812:Vmn2r75 UTSW 7 86165367 missense probably benign 0.38
R0891:Vmn2r75 UTSW 7 86164268 missense possibly damaging 0.81
R1340:Vmn2r75 UTSW 7 86148590 missense probably damaging 0.98
R1501:Vmn2r75 UTSW 7 86165642 missense possibly damaging 0.85
R1760:Vmn2r75 UTSW 7 86148811 missense probably damaging 1.00
R1970:Vmn2r75 UTSW 7 86148262 missense probably damaging 1.00
R2060:Vmn2r75 UTSW 7 86165164 missense probably benign 0.00
R2292:Vmn2r75 UTSW 7 86148936 missense probably damaging 1.00
R3688:Vmn2r75 UTSW 7 86148421 missense probably damaging 0.99
R3892:Vmn2r75 UTSW 7 86164286 missense probably null 1.00
R4532:Vmn2r75 UTSW 7 86148141 nonsense probably null
R4583:Vmn2r75 UTSW 7 86164082 missense possibly damaging 0.81
R4592:Vmn2r75 UTSW 7 86166286 missense probably benign 0.00
R4792:Vmn2r75 UTSW 7 86163170 missense possibly damaging 0.46
R4859:Vmn2r75 UTSW 7 86148403 missense probably benign 0.35
R4896:Vmn2r75 UTSW 7 86171579 missense probably benign 0.01
R4943:Vmn2r75 UTSW 7 86165497 missense probably damaging 1.00
R4992:Vmn2r75 UTSW 7 86166167 critical splice donor site probably null
R5048:Vmn2r75 UTSW 7 86165527 missense possibly damaging 0.66
R5063:Vmn2r75 UTSW 7 86164164 missense probably benign
R5156:Vmn2r75 UTSW 7 86164228 missense possibly damaging 0.51
R5243:Vmn2r75 UTSW 7 86164239 missense probably damaging 1.00
R5574:Vmn2r75 UTSW 7 86166302 missense probably benign 0.22
R5622:Vmn2r75 UTSW 7 86148494 missense probably benign 0.15
R5680:Vmn2r75 UTSW 7 86171571 missense probably benign 0.10
R5884:Vmn2r75 UTSW 7 86165370 missense probably benign
R6021:Vmn2r75 UTSW 7 86171612 missense probably benign 0.01
R6217:Vmn2r75 UTSW 7 86166167 critical splice donor site probably benign
R6242:Vmn2r75 UTSW 7 86165384 missense probably damaging 1.00
R6299:Vmn2r75 UTSW 7 86165274 missense probably benign 0.12
R6441:Vmn2r75 UTSW 7 86171576 missense probably damaging 0.99
R6495:Vmn2r75 UTSW 7 86164079 missense probably benign 0.00
R6553:Vmn2r75 UTSW 7 86164245 missense probably benign 0.28
R6670:Vmn2r75 UTSW 7 86148436 missense probably damaging 1.00
R7078:Vmn2r75 UTSW 7 86166360 missense probably damaging 1.00
R7164:Vmn2r75 UTSW 7 86165384 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCATGCCCACTTATGATAAAG -3'
(R):5'- TCTGTTTTCAGGGTGACACC -3'

Sequencing Primer
(F):5'- ATTACCTTCATACTGTGGTGAGAAAG -3'
(R):5'- CCCAAGACAAACCATTTAATTTTCTC -3'
Posted On2016-07-22