Incidental Mutation 'R5277:Olfr607'
ID404002
Institutional Source Beutler Lab
Gene Symbol Olfr607
Ensembl Gene ENSMUSG00000081945
Gene Nameolfactory receptor 607
SynonymsEG546989, GA_x6K02T2PBJ9-6182881-6181898, MOR33-3P
MMRRC Submission 042864-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R5277 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103455526-103464151 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103460941 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 84 (L84H)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119283] [ENSMUST00000214347]
Predicted Effect probably damaging
Transcript: ENSMUST00000045546
AA Change: L84H

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041119
Gene: ENSMUSG00000042402
AA Change: L84H

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:7tm_4 32 305 9.9e-102 PFAM
Pfam:7TM_GPCR_Srsx 36 304 3.7e-8 PFAM
Pfam:7tm_1 42 293 5e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119283
AA Change: L84H

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214347
AA Change: L89H

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Olfr607
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Olfr607 APN 7 103461014 missense possibly damaging 0.90
R0919:Olfr607 UTSW 7 103460812 missense probably damaging 1.00
R2105:Olfr607 UTSW 7 103460273 splice site probably null
R2332:Olfr607 UTSW 7 103461086 missense probably damaging 1.00
R4656:Olfr607 UTSW 7 103460488 missense probably benign 0.05
R4859:Olfr607 UTSW 7 103461036 nonsense probably null
R5260:Olfr607 UTSW 7 103460615 missense probably benign 0.03
R5572:Olfr607 UTSW 7 103460698 missense probably benign 0.02
R5593:Olfr607 UTSW 7 103460385 synonymous silent
R5788:Olfr607 UTSW 7 103460879 missense possibly damaging 0.49
Z1177:Olfr607 UTSW 7 103460466 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCGGCAAAAGTCCAAGCGG -3'
(R):5'- TGGATGTCCATACCTTTCAGC -3'

Sequencing Primer
(F):5'- CCTTGCCAATGATAGAGCTTG -3'
(R):5'- GGATGTCCATACCTTTCAGCTTCATG -3'
Posted On2016-07-22