Incidental Mutation 'R5277:Neurog3'
ID404008
Institutional Source Beutler Lab
Gene Symbol Neurog3
Ensembl Gene ENSMUSG00000044312
Gene Nameneurogenin 3
SynonymsAtoh5, Math4B, bHLHa7, ngn3
MMRRC Submission 042864-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5277 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62133090-62134763 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62133853 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 36 (Y36N)
Ref Sequence ENSEMBL: ENSMUSP00000151551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027719] [ENSMUST00000050103] [ENSMUST00000141724] [ENSMUST00000150057] [ENSMUST00000156798] [ENSMUST00000218121]
Predicted Effect probably benign
Transcript: ENSMUST00000027719
SMART Domains Protein: ENSMUSP00000027719
Gene: ENSMUSG00000020083

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
Pfam:DUF4605 41 100 9.6e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000050103
AA Change: Y131N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054054
Gene: ENSMUSG00000044312
AA Change: Y131N

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 59 70 N/A INTRINSIC
HLH 89 141 7.94e-18 SMART
low complexity region 156 171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138450
Predicted Effect probably benign
Transcript: ENSMUST00000141724
SMART Domains Protein: ENSMUSP00000119343
Gene: ENSMUSG00000020083

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
low complexity region 59 83 N/A INTRINSIC
Pfam:DUF4605 84 123 6.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150057
Predicted Effect probably benign
Transcript: ENSMUST00000156798
SMART Domains Protein: ENSMUSP00000115712
Gene: ENSMUSG00000020083

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 36 60 N/A INTRINSIC
Pfam:DUF4605 61 100 3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218121
AA Change: Y36N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218216
Meta Mutation Damage Score 0.9705 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a basic helix-loop-helix (bHLH) transcription factor involved in neurogenesis. The encoded protein likely acts as a heterodimer with another bHLH protein. Defects in this gene are a cause of congenital malabsorptive diarrhea 4 (DIAR4).[provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for targeted null mutations are deficient in endocrine cells of the glandular stomach and intestinal epithelium, and lack glucagon- and insulin-producing cells of the pancreas. Mutants die postnatally from diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Neurog3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4592:Neurog3 UTSW 10 62133820 missense probably damaging 1.00
R7076:Neurog3 UTSW 10 62133580 missense probably benign
R7540:Neurog3 UTSW 10 62133977 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ATACCTAGGGACTGCTCCGAAG -3'
(R):5'- AAGTCTGAGAACACCAGTGC -3'

Sequencing Primer
(F):5'- CAGAAGTGGGTGACTGCC -3'
(R):5'- TGCAGGCCAGGGAATTCCTC -3'
Posted On2016-07-22