Incidental Mutation 'R5277:Ric8b'
ID404009
Institutional Source Beutler Lab
Gene Symbol Ric8b
Ensembl Gene ENSMUSG00000035620
Gene NameRIC8 guanine nucleotide exchange factor B
SynonymsRic-8b, Ric-8
MMRRC Submission 042864-MU
Accession Numbers

Genbank: NM_001013441, NM_183172; MGI: 2682307

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5277 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location84917616-85018337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84947652 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 125 (V125M)
Ref Sequence ENSEMBL: ENSMUSP00000093032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038523] [ENSMUST00000095385] [ENSMUST00000214693]
Predicted Effect probably damaging
Transcript: ENSMUST00000038523
AA Change: V125M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046981
Gene: ENSMUSG00000035620
AA Change: V125M

DomainStartEndE-ValueType
Pfam:Ric8 66 538 8.1e-125 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095385
AA Change: V125M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093032
Gene: ENSMUSG00000035620
AA Change: V125M

DomainStartEndE-ValueType
Pfam:Ric8 66 486 1.2e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217175
Meta Mutation Damage Score 0.8555 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
Allele List at MGI

All alleles(24) : Targeted, other(4) Gene trapped(20)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Ric8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02254:Ric8b APN 10 84980136 missense probably damaging 1.00
IGL02388:Ric8b APN 10 84992271 unclassified probably benign
IGL02435:Ric8b APN 10 84980076 missense probably benign 0.06
IGL02890:Ric8b APN 10 85001867 missense possibly damaging 0.80
IGL03163:Ric8b APN 10 85001822 missense probably damaging 1.00
IGL03211:Ric8b APN 10 85001793 missense probably damaging 1.00
D4216:Ric8b UTSW 10 85015141 missense probably damaging 0.99
R0491:Ric8b UTSW 10 84992222 missense probably damaging 1.00
R0612:Ric8b UTSW 10 85001881 missense probably damaging 1.00
R1077:Ric8b UTSW 10 84970717 splice site probably benign
R1448:Ric8b UTSW 10 84947671 missense possibly damaging 0.93
R1565:Ric8b UTSW 10 84980099 missense probably benign 0.01
R1617:Ric8b UTSW 10 84947611 missense probably damaging 0.98
R1634:Ric8b UTSW 10 84970748 missense probably damaging 1.00
R1983:Ric8b UTSW 10 85001838 missense probably damaging 0.99
R2339:Ric8b UTSW 10 84970024 missense probably benign 0.00
R2897:Ric8b UTSW 10 84947897 missense probably benign 0.01
R2898:Ric8b UTSW 10 84947897 missense probably benign 0.01
R4657:Ric8b UTSW 10 84992137 missense probably damaging 1.00
R4747:Ric8b UTSW 10 84917764 missense probably benign 0.36
R4953:Ric8b UTSW 10 84958082 missense possibly damaging 0.92
R5308:Ric8b UTSW 10 84947747 missense probably benign
R5326:Ric8b UTSW 10 84992212 missense probably damaging 1.00
R6248:Ric8b UTSW 10 84947845 missense probably damaging 1.00
R6782:Ric8b UTSW 10 84947527 missense probably damaging 1.00
R7548:Ric8b UTSW 10 84947872 missense probably damaging 1.00
R8123:Ric8b UTSW 10 84969873 missense probably damaging 1.00
Z1176:Ric8b UTSW 10 84947544 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACGACATGCCAAGTGTCCTG -3'
(R):5'- AAGATCTGGGTTAGCAGCGG -3'

Sequencing Primer
(F):5'- ATGCCAAGTGTCCTGCCTGG -3'
(R):5'- GCTCATAGCGCAATTGTGAC -3'
Posted On2016-07-22